Incidental Mutation 'R8402:Ddit4l'
ID 652227
Institutional Source Beutler Lab
Gene Symbol Ddit4l
Ensembl Gene ENSMUSG00000046818
Gene Name DNA-damage-inducible transcript 4-like
Synonyms 1700037B15Rik, REDD2, 1700108M02Rik, RTP801L
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock # R8402 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 137621612-137628333 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 137626127 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 85 (T85A)
Ref Sequence ENSEMBL: ENSMUSP00000058896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053855] [ENSMUST00000165845]
AlphaFold Q8VHZ5
Predicted Effect probably damaging
Transcript: ENSMUST00000053855
AA Change: T85A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058896
Gene: ENSMUSG00000046818
AA Change: T85A

DomainStartEndE-ValueType
Pfam:RTP801_C 65 183 1.4e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165845
AA Change: T85A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127567
Gene: ENSMUSG00000046818
AA Change: T85A

DomainStartEndE-ValueType
Pfam:RTP801_C 65 100 6.1e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,323,044 D157V possibly damaging Het
Adamts12 A T 15: 11,263,290 K579N probably damaging Het
Adcy7 T C 8: 88,308,735 V89A probably benign Het
Anapc1 G A 2: 128,630,228 S1458L probably benign Het
AW551984 T C 9: 39,597,653 Y325C probably damaging Het
Btnl4 T C 17: 34,469,493 Y437C probably damaging Het
Ccdc88a T A 11: 29,463,879 S806T probably damaging Het
Dmxl1 G A 18: 49,878,326 W1183* probably null Het
Dmxl1 G C 18: 49,878,327 D1184H probably benign Het
Dmxl1 G T 18: 49,878,342 V1189L probably benign Het
Evpl T C 11: 116,225,371 D820G probably benign Het
Fam76b T C 9: 13,839,676 S289P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gabrb2 T C 11: 42,487,304 W116R probably damaging Het
Galnt7 G A 8: 57,542,919 A355V probably damaging Het
Klk1b5 T G 7: 44,218,538 F45V probably benign Het
Nav2 T C 7: 49,453,437 V661A probably benign Het
Nfkbiz T C 16: 55,816,387 N517S probably damaging Het
Olfr1330 A G 4: 118,893,519 I145M probably benign Het
Olfr975 T A 9: 39,950,417 Y118F probably benign Het
P2rx1 T C 11: 73,013,889 F368L probably damaging Het
Palld A T 8: 61,711,406 V417E probably damaging Het
Robo1 C A 16: 73,024,497 A1375E probably benign Het
Rps24 G T 14: 24,490,761 probably benign Het
Serpind1 A G 16: 17,337,085 N259D probably benign Het
Sh3bp4 C A 1: 89,145,315 N628K probably benign Het
Tada3 A T 6: 113,374,813 L177Q probably damaging Het
Tcam1 T A 11: 106,286,905 L508Q probably damaging Het
Thbs1 T C 2: 118,115,878 S360P possibly damaging Het
Tmem33 T C 5: 67,267,375 probably benign Het
Vmn2r3 A G 3: 64,271,196 probably benign Het
Vwa3b A G 1: 37,165,798 E121G probably damaging Het
Zfp607b T A 7: 27,702,702 H194Q probably damaging Het
Zfp729b G A 13: 67,592,577 P523L probably damaging Het
Other mutations in Ddit4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03004:Ddit4l APN 3 137626205 missense probably benign 0.00
R0265:Ddit4l UTSW 3 137624287 splice site probably benign
R0357:Ddit4l UTSW 3 137626185 missense probably benign 0.40
R1550:Ddit4l UTSW 3 137624275 critical splice donor site probably null
R6572:Ddit4l UTSW 3 137626350 missense probably benign 0.16
R6667:Ddit4l UTSW 3 137626121 missense probably benign 0.29
R7428:Ddit4l UTSW 3 137626170 missense probably damaging 1.00
R8364:Ddit4l UTSW 3 137624235 nonsense probably null
Z1088:Ddit4l UTSW 3 137626362 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCCAGTAAGACCTCGTACAC -3'
(R):5'- AGCTCTCCTGCTTAAACACAAG -3'

Sequencing Primer
(F):5'- GTAAGACCTCGTACACCTTGC -3'
(R):5'- TCTCCAAGTTCACGTGCA -3'
Posted On 2020-10-20