Incidental Mutation 'R8402:Olfr1330'
ID 652228
Institutional Source Beutler Lab
Gene Symbol Olfr1330
Ensembl Gene ENSMUSG00000073768
Gene Name olfactory receptor 1330
Synonyms GA_x6K02T2QD9B-18644371-18643424, MOR259-8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R8402 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 118888597-118899597 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118893519 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 145 (I145M)
Ref Sequence ENSEMBL: ENSMUSP00000100652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094830] [ENSMUST00000105035] [ENSMUST00000106361]
AlphaFold Q8VEY6
Predicted Effect probably benign
Transcript: ENSMUST00000094830
AA Change: I145M

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000092425
Gene: ENSMUSG00000073768
AA Change: I145M

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 1.2e-53 PFAM
Pfam:7TM_GPCR_Srsx 38 308 1.4e-6 PFAM
Pfam:7tm_1 44 293 1.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105035
AA Change: I145M

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000100652
Gene: ENSMUSG00000073768
AA Change: I145M

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 307 6.4e-8 PFAM
Pfam:7tm_1 44 293 2.9e-31 PFAM
Pfam:7tm_4 142 286 6.7e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106361
AA Change: I145M

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101968
Gene: ENSMUSG00000073768
AA Change: I145M

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 6.1e-56 PFAM
Pfam:7tm_1 43 292 3.9e-25 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,323,044 D157V possibly damaging Het
Adamts12 A T 15: 11,263,290 K579N probably damaging Het
Adcy7 T C 8: 88,308,735 V89A probably benign Het
Anapc1 G A 2: 128,630,228 S1458L probably benign Het
AW551984 T C 9: 39,597,653 Y325C probably damaging Het
Btnl4 T C 17: 34,469,493 Y437C probably damaging Het
Ccdc88a T A 11: 29,463,879 S806T probably damaging Het
Ddit4l A G 3: 137,626,127 T85A probably damaging Het
Dmxl1 G A 18: 49,878,326 W1183* probably null Het
Dmxl1 G C 18: 49,878,327 D1184H probably benign Het
Dmxl1 G T 18: 49,878,342 V1189L probably benign Het
Evpl T C 11: 116,225,371 D820G probably benign Het
Fam76b T C 9: 13,839,676 S289P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gabrb2 T C 11: 42,487,304 W116R probably damaging Het
Galnt7 G A 8: 57,542,919 A355V probably damaging Het
Klk1b5 T G 7: 44,218,538 F45V probably benign Het
Nav2 T C 7: 49,453,437 V661A probably benign Het
Nfkbiz T C 16: 55,816,387 N517S probably damaging Het
Olfr975 T A 9: 39,950,417 Y118F probably benign Het
P2rx1 T C 11: 73,013,889 F368L probably damaging Het
Palld A T 8: 61,711,406 V417E probably damaging Het
Robo1 C A 16: 73,024,497 A1375E probably benign Het
Rps24 G T 14: 24,490,761 probably benign Het
Serpind1 A G 16: 17,337,085 N259D probably benign Het
Sh3bp4 C A 1: 89,145,315 N628K probably benign Het
Tada3 A T 6: 113,374,813 L177Q probably damaging Het
Tcam1 T A 11: 106,286,905 L508Q probably damaging Het
Thbs1 T C 2: 118,115,878 S360P possibly damaging Het
Tmem33 T C 5: 67,267,375 probably benign Het
Vmn2r3 A G 3: 64,271,196 probably benign Het
Vwa3b A G 1: 37,165,798 E121G probably damaging Het
Zfp607b T A 7: 27,702,702 H194Q probably damaging Het
Zfp729b G A 13: 67,592,577 P523L probably damaging Het
Other mutations in Olfr1330
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Olfr1330 APN 4 118893551 missense probably benign 0.00
IGL01642:Olfr1330 APN 4 118893461 missense probably damaging 1.00
R0402:Olfr1330 UTSW 4 118893229 missense possibly damaging 0.95
R0418:Olfr1330 UTSW 4 118893251 missense possibly damaging 0.51
R0646:Olfr1330 UTSW 4 118893490 missense probably damaging 0.96
R1075:Olfr1330 UTSW 4 118893205 missense probably damaging 1.00
R1743:Olfr1330 UTSW 4 118893526 missense probably benign
R1950:Olfr1330 UTSW 4 118893340 missense probably benign 0.22
R2265:Olfr1330 UTSW 4 118893874 missense probably damaging 1.00
R2268:Olfr1330 UTSW 4 118893874 missense probably damaging 1.00
R2269:Olfr1330 UTSW 4 118893874 missense probably damaging 1.00
R4648:Olfr1330 UTSW 4 118893950 missense possibly damaging 0.84
R5635:Olfr1330 UTSW 4 118893635 missense probably benign 0.31
R6881:Olfr1330 UTSW 4 118893107 missense probably damaging 1.00
R7351:Olfr1330 UTSW 4 118893836 missense probably benign 0.05
R7412:Olfr1330 UTSW 4 118893130 missense possibly damaging 0.83
R9355:Olfr1330 UTSW 4 118893587 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGCTATGTCACCACCACC -3'
(R):5'- ACCAATGTAGGAGGCCACAATG -3'

Sequencing Primer
(F):5'- ACCATGCCCCAGATGTTG -3'
(R):5'- TGAGGGAAATTGGAATCACAATCAC -3'
Posted On 2020-10-20