Incidental Mutation 'R8402:Tada3'
ID 652229
Institutional Source Beutler Lab
Gene Symbol Tada3
Ensembl Gene ENSMUSG00000048930
Gene Name transcriptional adaptor 3
Synonyms ADA3, Tada3l, 1110004B19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8402 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 113366025-113377883 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 113374813 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 177 (L177Q)
Ref Sequence ENSEMBL: ENSMUSP00000032410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032410] [ENSMUST00000043333] [ENSMUST00000099118] [ENSMUST00000156898] [ENSMUST00000171058] [ENSMUST00000193384] [ENSMUST00000203578] [ENSMUST00000204802]
AlphaFold Q8R0L9
Predicted Effect probably damaging
Transcript: ENSMUST00000032410
AA Change: L177Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032410
Gene: ENSMUSG00000048930
AA Change: L177Q

DomainStartEndE-ValueType
coiled coil region 47 67 N/A INTRINSIC
low complexity region 108 121 N/A INTRINSIC
Pfam:Ada3 309 430 1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043333
SMART Domains Protein: ENSMUSP00000043363
Gene: ENSMUSG00000048930

DomainStartEndE-ValueType
coiled coil region 47 67 N/A INTRINSIC
low complexity region 108 121 N/A INTRINSIC
Pfam:Ada3 289 413 2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099118
SMART Domains Protein: ENSMUSP00000108736
Gene: ENSMUSG00000048930

DomainStartEndE-ValueType
Pfam:Ada3 108 232 6.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156898
SMART Domains Protein: ENSMUSP00000114839
Gene: ENSMUSG00000079426

DomainStartEndE-ValueType
Pfam:ARPC4 1 167 8.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171058
SMART Domains Protein: ENSMUSP00000131690
Gene: ENSMUSG00000079426

DomainStartEndE-ValueType
Pfam:ARPC4 1 91 1.1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193384
Predicted Effect probably benign
Transcript: ENSMUST00000203578
SMART Domains Protein: ENSMUSP00000145344
Gene: ENSMUSG00000079426

DomainStartEndE-ValueType
Pfam:ARPC4 1 77 1.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204802
SMART Domains Protein: ENSMUSP00000144751
Gene: ENSMUSG00000079426

DomainStartEndE-ValueType
Pfam:ARPC4 1 77 1.2e-41 PFAM
Meta Mutation Damage Score 0.5353 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA-binding transcriptional activator proteins increase the rate of transcription by interacting with the transcriptional machinery bound to the basal promoter in conjunction with adaptor proteins, possibly by acetylation and destabilization of nucleosomes. The protein encoded by this gene is a transcriptional activator adaptor and a component of the histone acetyl transferase (HAT) coactivator complex which plays a crucial role in chromatin modulation and cell cycle progression. Along with the other components of the complex, this protein links transcriptional activators bound to specific promoters, to histone acetylation and the transcriptional machinery. The protein is also involved in the stabilization and activation of the p53 tumor suppressor protein that plays a role in the cellular response to DNA damage. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E3.5 and E8.5 associated with impaired proliferation of trophoblast cells and absence of inner cell mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,323,044 D157V possibly damaging Het
Adamts12 A T 15: 11,263,290 K579N probably damaging Het
Adcy7 T C 8: 88,308,735 V89A probably benign Het
Anapc1 G A 2: 128,630,228 S1458L probably benign Het
AW551984 T C 9: 39,597,653 Y325C probably damaging Het
Btnl4 T C 17: 34,469,493 Y437C probably damaging Het
Ccdc88a T A 11: 29,463,879 S806T probably damaging Het
Ddit4l A G 3: 137,626,127 T85A probably damaging Het
Dmxl1 G A 18: 49,878,326 W1183* probably null Het
Dmxl1 G C 18: 49,878,327 D1184H probably benign Het
Dmxl1 G T 18: 49,878,342 V1189L probably benign Het
Evpl T C 11: 116,225,371 D820G probably benign Het
Fam76b T C 9: 13,839,676 S289P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gabrb2 T C 11: 42,487,304 W116R probably damaging Het
Galnt7 G A 8: 57,542,919 A355V probably damaging Het
Klk1b5 T G 7: 44,218,538 F45V probably benign Het
Nav2 T C 7: 49,453,437 V661A probably benign Het
Nfkbiz T C 16: 55,816,387 N517S probably damaging Het
Olfr1330 A G 4: 118,893,519 I145M probably benign Het
Olfr975 T A 9: 39,950,417 Y118F probably benign Het
P2rx1 T C 11: 73,013,889 F368L probably damaging Het
Palld A T 8: 61,711,406 V417E probably damaging Het
Robo1 C A 16: 73,024,497 A1375E probably benign Het
Rps24 G T 14: 24,490,761 probably benign Het
Serpind1 A G 16: 17,337,085 N259D probably benign Het
Sh3bp4 C A 1: 89,145,315 N628K probably benign Het
Tcam1 T A 11: 106,286,905 L508Q probably damaging Het
Thbs1 T C 2: 118,115,878 S360P possibly damaging Het
Tmem33 T C 5: 67,267,375 probably benign Het
Vmn2r3 A G 3: 64,271,196 probably benign Het
Vwa3b A G 1: 37,165,798 E121G probably damaging Het
Zfp607b T A 7: 27,702,702 H194Q probably damaging Het
Zfp729b G A 13: 67,592,577 P523L probably damaging Het
Other mutations in Tada3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Tada3 APN 6 113376012 missense probably benign 0.41
IGL03256:Tada3 APN 6 113375131 missense possibly damaging 0.83
R0208:Tada3 UTSW 6 113367007 missense probably damaging 1.00
R0542:Tada3 UTSW 6 113375214 missense probably damaging 0.99
R0698:Tada3 UTSW 6 113367007 missense probably damaging 1.00
R2120:Tada3 UTSW 6 113371015 missense possibly damaging 0.50
R4384:Tada3 UTSW 6 113370379 missense probably damaging 1.00
R7844:Tada3 UTSW 6 113370960 missense probably benign 0.05
R9289:Tada3 UTSW 6 113370303 missense possibly damaging 0.92
Z1176:Tada3 UTSW 6 113375862 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTGAGCCTCACTGTCTG -3'
(R):5'- GGATCCCCAAGAATGATGCTC -3'

Sequencing Primer
(F):5'- CTCACTGTCTGCAGGGGTCATG -3'
(R):5'- GAATGATGCTCCCAACAGGTTCTG -3'
Posted On 2020-10-20