Mutagenetix > Incidental Mutation

Incidental Mutation 'R8402:Tada3'

652229

Institutional Source

Beutler Lab

Gene Symbol

Tada3

Ensembl Gene

ENSMUSG00000048930

Gene Name

transcriptional adaptor 3

Synonyms

ADA3, Tada3l, 1110004B19Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8402 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

113366025-113377883 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 113374813 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 177 (L177Q)

Ref Sequence

ENSEMBL: ENSMUSP00000032410 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032410] [ENSMUST00000043333] [ENSMUST00000099118] [ENSMUST00000156898] [ENSMUST00000171058] [ENSMUST00000193384] [ENSMUST00000203578] [ENSMUST00000204802]

AlphaFold

Q8R0L9

Predicted Effect

probably damaging
Transcript: ENSMUST00000032410
AA Change: L177Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000032410
Gene: ENSMUSG00000048930
AA Change: L177Q

Domain	Start	End	E-Value	Type
coiled coil region	47	67	N/A	INTRINSIC
low complexity region	108	121	N/A	INTRINSIC
Pfam:Ada3	309	430	1e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000043333

SMART Domains

Protein: ENSMUSP00000043363
Gene: ENSMUSG00000048930

Domain	Start	End	E-Value	Type
coiled coil region	47	67	N/A	INTRINSIC
low complexity region	108	121	N/A	INTRINSIC
Pfam:Ada3	289	413	2e-31	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000099118

SMART Domains

Protein: ENSMUSP00000108736
Gene: ENSMUSG00000048930

Domain	Start	End	E-Value	Type
Pfam:Ada3	108	232	6.7e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000156898

SMART Domains

Protein: ENSMUSP00000114839
Gene: ENSMUSG00000079426

Domain	Start	End	E-Value	Type
Pfam:ARPC4	1	167	8.3e-88	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171058

SMART Domains

Protein: ENSMUSP00000131690
Gene: ENSMUSG00000079426

Domain	Start	End	E-Value	Type
Pfam:ARPC4	1	91	1.1e-46	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000193384

Predicted Effect

probably benign
Transcript: ENSMUST00000203578

SMART Domains

Protein: ENSMUSP00000145344
Gene: ENSMUSG00000079426

Domain	Start	End	E-Value	Type
Pfam:ARPC4	1	77	1.2e-41	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000204802

SMART Domains

Protein: ENSMUSP00000144751
Gene: ENSMUSG00000079426

Domain	Start	End	E-Value	Type
Pfam:ARPC4	1	77	1.2e-41	PFAM

Meta Mutation Damage Score

0.5353

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA-binding transcriptional activator proteins increase the rate of transcription by interacting with the transcriptional machinery bound to the basal promoter in conjunction with adaptor proteins, possibly by acetylation and destabilization of nucleosomes. The protein encoded by this gene is a transcriptional activator adaptor and a component of the histone acetyl transferase (HAT) coactivator complex which plays a crucial role in chromatin modulation and cell cycle progression. Along with the other components of the complex, this protein links transcriptional activators bound to specific promoters, to histone acetylation and the transcriptional machinery. The protein is also involved in the stabilization and activation of the p53 tumor suppressor protein that plays a role in the cellular response to DNA damage. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E3.5 and E8.5 associated with impaired proliferation of trophoblast cells and absence of inner cell mass. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	T	A	6: 129,323,044	D157V	possibly damaging	Het
Adamts12	A	T	15: 11,263,290	K579N	probably damaging	Het
Adcy7	T	C	8: 88,308,735	V89A	probably benign	Het
Anapc1	G	A	2: 128,630,228	S1458L	probably benign	Het
AW551984	T	C	9: 39,597,653	Y325C	probably damaging	Het
Btnl4	T	C	17: 34,469,493	Y437C	probably damaging	Het
Ccdc88a	T	A	11: 29,463,879	S806T	probably damaging	Het
Ddit4l	A	G	3: 137,626,127	T85A	probably damaging	Het
Dmxl1	G	A	18: 49,878,326	W1183*	probably null	Het
Dmxl1	G	C	18: 49,878,327	D1184H	probably benign	Het
Dmxl1	G	T	18: 49,878,342	V1189L	probably benign	Het
Evpl	T	C	11: 116,225,371	D820G	probably benign	Het
Fam76b	T	C	9: 13,839,676	S289P	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Gabrb2	T	C	11: 42,487,304	W116R	probably damaging	Het
Galnt7	G	A	8: 57,542,919	A355V	probably damaging	Het
Klk1b5	T	G	7: 44,218,538	F45V	probably benign	Het
Nav2	T	C	7: 49,453,437	V661A	probably benign	Het
Nfkbiz	T	C	16: 55,816,387	N517S	probably damaging	Het
Olfr1330	A	G	4: 118,893,519	I145M	probably benign	Het
Olfr975	T	A	9: 39,950,417	Y118F	probably benign	Het
P2rx1	T	C	11: 73,013,889	F368L	probably damaging	Het
Palld	A	T	8: 61,711,406	V417E	probably damaging	Het
Robo1	C	A	16: 73,024,497	A1375E	probably benign	Het
Rps24	G	T	14: 24,490,761		probably benign	Het
Serpind1	A	G	16: 17,337,085	N259D	probably benign	Het
Sh3bp4	C	A	1: 89,145,315	N628K	probably benign	Het
Tcam1	T	A	11: 106,286,905	L508Q	probably damaging	Het
Thbs1	T	C	2: 118,115,878	S360P	possibly damaging	Het
Tmem33	T	C	5: 67,267,375		probably benign	Het
Vmn2r3	A	G	3: 64,271,196		probably benign	Het
Vwa3b	A	G	1: 37,165,798	E121G	probably damaging	Het
Zfp607b	T	A	7: 27,702,702	H194Q	probably damaging	Het
Zfp729b	G	A	13: 67,592,577	P523L	probably damaging	Het

Other mutations in Tada3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01635:Tada3	APN	6	113376012	missense	probably benign	0.41
IGL03256:Tada3	APN	6	113375131	missense	possibly damaging	0.83
R0208:Tada3	UTSW	6	113367007	missense	probably damaging	1.00
R0542:Tada3	UTSW	6	113375214	missense	probably damaging	0.99
R0698:Tada3	UTSW	6	113367007	missense	probably damaging	1.00
R2120:Tada3	UTSW	6	113371015	missense	possibly damaging	0.50
R4384:Tada3	UTSW	6	113370379	missense	probably damaging	1.00
R7844:Tada3	UTSW	6	113370960	missense	probably benign	0.05
R9289:Tada3	UTSW	6	113370303	missense	possibly damaging	0.92
R9771:Tada3	UTSW	6	113372358	missense	probably benign	0.01
Z1176:Tada3	UTSW	6	113375862	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGCTGAGCCTCACTGTCTG -3'
(R):5'- GGATCCCCAAGAATGATGCTC -3'

Sequencing Primer
(F):5'- CTCACTGTCTGCAGGGGTCATG -3'
(R):5'- GAATGATGCTCCCAACAGGTTCTG -3'

Posted On

2020-10-20