Incidental Mutation 'R8402:4922502D21Rik'
ID652230
Institutional Source Beutler Lab
Gene Symbol 4922502D21Rik
Ensembl Gene ENSMUSG00000047720
Gene NameRIKEN cDNA 4922502D21 gene
SynonymsLOC381816
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R8402 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location129322164-129331796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129323044 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 157 (D157V)
Ref Sequence ENSEMBL: ENSMUSP00000062024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051283]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051283
AA Change: D157V

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062024
Gene: ENSMUSG00000047720
AA Change: D157V

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
CLECT 71 183 1.32e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203159
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A T 15: 11,263,290 K579N probably damaging Het
Adcy7 T C 8: 88,308,735 V89A probably benign Het
Anapc1 G A 2: 128,630,228 S1458L probably benign Het
AW551984 T C 9: 39,597,653 Y325C probably damaging Het
Btnl4 T C 17: 34,469,493 Y437C probably damaging Het
Ccdc88a T A 11: 29,463,879 S806T probably damaging Het
Ddit4l A G 3: 137,626,127 T85A probably damaging Het
Dmxl1 G A 18: 49,878,326 W1183* probably null Het
Dmxl1 G C 18: 49,878,327 D1184H probably benign Het
Dmxl1 G T 18: 49,878,342 V1189L probably benign Het
Evpl T C 11: 116,225,371 D820G probably benign Het
Fam76b T C 9: 13,839,676 S289P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gabrb2 T C 11: 42,487,304 W116R probably damaging Het
Galnt7 G A 8: 57,542,919 A355V probably damaging Het
Klk1b5 T G 7: 44,218,538 F45V probably benign Het
Nav2 T C 7: 49,453,437 V661A probably benign Het
Nfkbiz T C 16: 55,816,387 N517S probably damaging Het
Olfr1330 A G 4: 118,893,519 I145M probably benign Het
Olfr975 T A 9: 39,950,417 Y118F probably benign Het
P2rx1 T C 11: 73,013,889 F368L probably damaging Het
Palld A T 8: 61,711,406 V417E probably damaging Het
Robo1 C A 16: 73,024,497 A1375E probably benign Het
Serpind1 A G 16: 17,337,085 N259D probably benign Het
Sh3bp4 C A 1: 89,145,315 N628K probably benign Het
Tada3 A T 6: 113,374,813 L177Q probably damaging Het
Tcam1 T A 11: 106,286,905 L508Q probably damaging Het
Thbs1 T C 2: 118,115,878 S360P possibly damaging Het
Vwa3b A G 1: 37,165,798 E121G probably damaging Het
Zfp607b T A 7: 27,702,702 H194Q probably damaging Het
Zfp729b G A 13: 67,592,577 P523L probably damaging Het
Other mutations in 4922502D21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02053:4922502D21Rik APN 6 129326762 missense probably benign 0.00
IGL02298:4922502D21Rik APN 6 129331564 start codon destroyed probably benign 0.09
IGL03350:4922502D21Rik APN 6 129331023 missense probably benign 0.07
R0178:4922502D21Rik UTSW 6 129326823 missense probably benign 0.01
R0270:4922502D21Rik UTSW 6 129325608 nonsense probably null
R0414:4922502D21Rik UTSW 6 129326850 unclassified probably benign
R0648:4922502D21Rik UTSW 6 129330969 missense probably benign 0.03
R1065:4922502D21Rik UTSW 6 129323050 missense possibly damaging 0.83
R2075:4922502D21Rik UTSW 6 129326703 missense probably benign 0.01
R6163:4922502D21Rik UTSW 6 129326747 missense probably benign 0.00
R7092:4922502D21Rik UTSW 6 129323000 missense probably benign 0.12
R7107:4922502D21Rik UTSW 6 129322952 missense probably damaging 1.00
R7360:4922502D21Rik UTSW 6 129326747 missense probably benign 0.00
R7369:4922502D21Rik UTSW 6 129331533 missense possibly damaging 0.68
R7414:4922502D21Rik UTSW 6 129325633 missense probably benign 0.17
R7937:4922502D21Rik UTSW 6 129331011 missense possibly damaging 0.84
R8345:4922502D21Rik UTSW 6 129325630 missense probably damaging 1.00
X0026:4922502D21Rik UTSW 6 129326693 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTCGATGGAAAGGAATACACATCAC -3'
(R):5'- TAGGAGCATAGAGTCCCAGG -3'

Sequencing Primer
(F):5'- CAGACAAAACGAGACACTGCTCTTC -3'
(R):5'- CCAGGCCATGCTGCTTTTTAGAG -3'
Posted On2020-10-20