Incidental Mutation 'R8402:4922502D21Rik'
ID 652230
Institutional Source Beutler Lab
Gene Symbol 4922502D21Rik
Ensembl Gene ENSMUSG00000047720
Gene Name RIKEN cDNA 4922502D21 gene
Synonyms LOC381816
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R8402 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 129322164-129331796 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 129323044 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 157 (D157V)
Ref Sequence ENSEMBL: ENSMUSP00000062024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051283]
AlphaFold Q8C634
Predicted Effect possibly damaging
Transcript: ENSMUST00000051283
AA Change: D157V

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062024
Gene: ENSMUSG00000047720
AA Change: D157V

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
CLECT 71 183 1.32e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203159
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A T 15: 11,263,290 K579N probably damaging Het
Adcy7 T C 8: 88,308,735 V89A probably benign Het
Anapc1 G A 2: 128,630,228 S1458L probably benign Het
AW551984 T C 9: 39,597,653 Y325C probably damaging Het
Btnl4 T C 17: 34,469,493 Y437C probably damaging Het
Ccdc88a T A 11: 29,463,879 S806T probably damaging Het
Ddit4l A G 3: 137,626,127 T85A probably damaging Het
Dmxl1 G A 18: 49,878,326 W1183* probably null Het
Dmxl1 G C 18: 49,878,327 D1184H probably benign Het
Dmxl1 G T 18: 49,878,342 V1189L probably benign Het
Evpl T C 11: 116,225,371 D820G probably benign Het
Fam76b T C 9: 13,839,676 S289P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gabrb2 T C 11: 42,487,304 W116R probably damaging Het
Galnt7 G A 8: 57,542,919 A355V probably damaging Het
Klk1b5 T G 7: 44,218,538 F45V probably benign Het
Nav2 T C 7: 49,453,437 V661A probably benign Het
Nfkbiz T C 16: 55,816,387 N517S probably damaging Het
Olfr1330 A G 4: 118,893,519 I145M probably benign Het
Olfr975 T A 9: 39,950,417 Y118F probably benign Het
P2rx1 T C 11: 73,013,889 F368L probably damaging Het
Palld A T 8: 61,711,406 V417E probably damaging Het
Robo1 C A 16: 73,024,497 A1375E probably benign Het
Rps24 G T 14: 24,490,761 probably benign Het
Serpind1 A G 16: 17,337,085 N259D probably benign Het
Sh3bp4 C A 1: 89,145,315 N628K probably benign Het
Tada3 A T 6: 113,374,813 L177Q probably damaging Het
Tcam1 T A 11: 106,286,905 L508Q probably damaging Het
Thbs1 T C 2: 118,115,878 S360P possibly damaging Het
Tmem33 T C 5: 67,267,375 probably benign Het
Vmn2r3 A G 3: 64,271,196 probably benign Het
Vwa3b A G 1: 37,165,798 E121G probably damaging Het
Zfp607b T A 7: 27,702,702 H194Q probably damaging Het
Zfp729b G A 13: 67,592,577 P523L probably damaging Het
Other mutations in 4922502D21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02053:4922502D21Rik APN 6 129326762 missense probably benign 0.00
IGL02298:4922502D21Rik APN 6 129331564 start codon destroyed probably benign 0.09
IGL03350:4922502D21Rik APN 6 129331023 missense probably benign 0.07
R0178:4922502D21Rik UTSW 6 129326823 missense probably benign 0.01
R0270:4922502D21Rik UTSW 6 129325608 nonsense probably null
R0414:4922502D21Rik UTSW 6 129326850 unclassified probably benign
R0648:4922502D21Rik UTSW 6 129330969 missense probably benign 0.03
R1065:4922502D21Rik UTSW 6 129323050 missense possibly damaging 0.83
R2075:4922502D21Rik UTSW 6 129326703 missense probably benign 0.01
R6163:4922502D21Rik UTSW 6 129326747 missense probably benign 0.00
R7092:4922502D21Rik UTSW 6 129323000 missense probably benign 0.12
R7107:4922502D21Rik UTSW 6 129322952 missense probably damaging 1.00
R7360:4922502D21Rik UTSW 6 129326747 missense probably benign 0.00
R7369:4922502D21Rik UTSW 6 129331533 missense possibly damaging 0.68
R7414:4922502D21Rik UTSW 6 129325633 missense probably benign 0.17
R7937:4922502D21Rik UTSW 6 129331011 missense possibly damaging 0.84
R8345:4922502D21Rik UTSW 6 129325630 missense probably damaging 1.00
R8814:4922502D21Rik UTSW 6 129325604 intron probably benign
R8862:4922502D21Rik UTSW 6 129331531 missense probably benign 0.00
X0026:4922502D21Rik UTSW 6 129326693 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTCGATGGAAAGGAATACACATCAC -3'
(R):5'- TAGGAGCATAGAGTCCCAGG -3'

Sequencing Primer
(F):5'- CAGACAAAACGAGACACTGCTCTTC -3'
(R):5'- CCAGGCCATGCTGCTTTTTAGAG -3'
Posted On 2020-10-20