Incidental Mutation 'R8402:Klk1b5'
ID 652232
Institutional Source Beutler Lab
Gene Symbol Klk1b5
Ensembl Gene ENSMUSG00000066512
Gene Name kallikrein 1-related peptidase b5
Synonyms mGK-5, Klk5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R8402 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 44215945-44220703 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 44218538 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 45 (F45V)
Ref Sequence ENSEMBL: ENSMUSP00000073964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074359]
AlphaFold P15945
Predicted Effect probably benign
Transcript: ENSMUST00000074359
AA Change: F45V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000073964
Gene: ENSMUSG00000066512
AA Change: F45V

DomainStartEndE-ValueType
Tryp_SPc 24 253 1.49e-100 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,323,044 D157V possibly damaging Het
Adamts12 A T 15: 11,263,290 K579N probably damaging Het
Adcy7 T C 8: 88,308,735 V89A probably benign Het
Anapc1 G A 2: 128,630,228 S1458L probably benign Het
AW551984 T C 9: 39,597,653 Y325C probably damaging Het
Btnl4 T C 17: 34,469,493 Y437C probably damaging Het
Ccdc88a T A 11: 29,463,879 S806T probably damaging Het
Ddit4l A G 3: 137,626,127 T85A probably damaging Het
Dmxl1 G A 18: 49,878,326 W1183* probably null Het
Dmxl1 G C 18: 49,878,327 D1184H probably benign Het
Dmxl1 G T 18: 49,878,342 V1189L probably benign Het
Evpl T C 11: 116,225,371 D820G probably benign Het
Fam76b T C 9: 13,839,676 S289P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gabrb2 T C 11: 42,487,304 W116R probably damaging Het
Galnt7 G A 8: 57,542,919 A355V probably damaging Het
Nav2 T C 7: 49,453,437 V661A probably benign Het
Nfkbiz T C 16: 55,816,387 N517S probably damaging Het
Olfr1330 A G 4: 118,893,519 I145M probably benign Het
Olfr975 T A 9: 39,950,417 Y118F probably benign Het
P2rx1 T C 11: 73,013,889 F368L probably damaging Het
Palld A T 8: 61,711,406 V417E probably damaging Het
Robo1 C A 16: 73,024,497 A1375E probably benign Het
Rps24 G T 14: 24,490,761 probably benign Het
Serpind1 A G 16: 17,337,085 N259D probably benign Het
Sh3bp4 C A 1: 89,145,315 N628K probably benign Het
Tada3 A T 6: 113,374,813 L177Q probably damaging Het
Tcam1 T A 11: 106,286,905 L508Q probably damaging Het
Thbs1 T C 2: 118,115,878 S360P possibly damaging Het
Tmem33 T C 5: 67,267,375 probably benign Het
Vmn2r3 A G 3: 64,271,196 probably benign Het
Vwa3b A G 1: 37,165,798 E121G probably damaging Het
Zfp607b T A 7: 27,702,702 H194Q probably damaging Het
Zfp729b G A 13: 67,592,577 P523L probably damaging Het
Other mutations in Klk1b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Klk1b5 APN 7 44216504 missense probably benign 0.00
R0515:Klk1b5 UTSW 7 44218533 missense probably damaging 1.00
R0706:Klk1b5 UTSW 7 44218514 missense probably damaging 1.00
R1689:Klk1b5 UTSW 7 44220545 missense probably damaging 0.98
R1845:Klk1b5 UTSW 7 44220125 missense probably benign
R2153:Klk1b5 UTSW 7 44219898 critical splice donor site probably null
R8264:Klk1b5 UTSW 7 44220030 missense probably damaging 1.00
R8711:Klk1b5 UTSW 7 44218572 missense probably benign 0.02
R8886:Klk1b5 UTSW 7 44219768 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATAGATCTCCCTAACCAGG -3'
(R):5'- TAGTTTCAGCCAGTCCCACC -3'

Sequencing Primer
(F):5'- GACCATGTCCCCTGATCCCAG -3'
(R):5'- ACCTGCCTGCCCTTCAGTAC -3'
Posted On 2020-10-20