Incidental Mutation 'R8402:Nav2'
ID 652233
Institutional Source Beutler Lab
Gene Symbol Nav2
Ensembl Gene ENSMUSG00000052512
Gene Name neuron navigator 2
Synonyms Rainb1, Unc53H2, 5330421F07Rik, POMFIL2, HELAD1, RAINB2
MMRRC Submission 067878-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.571) question?
Stock # R8402 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 48608796-49259838 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 49103185 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 661 (V661A)
Ref Sequence ENSEMBL: ENSMUSP00000067448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064395] [ENSMUST00000183659] [ENSMUST00000184124] [ENSMUST00000184945]
AlphaFold E9Q842
Predicted Effect probably benign
Transcript: ENSMUST00000064395
AA Change: V661A

PolyPhen 2 Score 0.432 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512
AA Change: V661A

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183659
AA Change: V600A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512
AA Change: V600A

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
CH 23 126 6.19e-16 SMART
low complexity region 141 149 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
coiled coil region 425 455 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
low complexity region 552 564 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 859 883 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1001 1013 N/A INTRINSIC
low complexity region 1282 1299 N/A INTRINSIC
low complexity region 1307 1324 N/A INTRINSIC
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1465 1479 N/A INTRINSIC
low complexity region 1553 1567 N/A INTRINSIC
coiled coil region 1569 1656 N/A INTRINSIC
low complexity region 1728 1739 N/A INTRINSIC
coiled coil region 1780 1848 N/A INTRINSIC
AAA 2032 2186 1.69e-5 SMART
low complexity region 2343 2369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184124
Predicted Effect possibly damaging
Transcript: ENSMUST00000184945
AA Change: V661A

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512
AA Change: V661A

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display impaired olfaction and hearing, increased latency in a hot plate test, degeneration of the optic nerve, decreased exploration in new environments, and weight loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A T 15: 11,263,376 (GRCm39) K579N probably damaging Het
Adcy7 T C 8: 89,035,363 (GRCm39) V89A probably benign Het
Anapc1 G A 2: 128,472,148 (GRCm39) S1458L probably benign Het
AW551984 T C 9: 39,508,949 (GRCm39) Y325C probably damaging Het
Btnl4 T C 17: 34,688,467 (GRCm39) Y437C probably damaging Het
Ccdc88a T A 11: 29,413,879 (GRCm39) S806T probably damaging Het
Clec2m T A 6: 129,300,007 (GRCm39) D157V possibly damaging Het
Ddit4l A G 3: 137,331,888 (GRCm39) T85A probably damaging Het
Dmxl1 G A 18: 50,011,393 (GRCm39) W1183* probably null Het
Dmxl1 G C 18: 50,011,394 (GRCm39) D1184H probably benign Het
Dmxl1 G T 18: 50,011,409 (GRCm39) V1189L probably benign Het
Evpl T C 11: 116,116,197 (GRCm39) D820G probably benign Het
Fam76b T C 9: 13,750,972 (GRCm39) S289P probably damaging Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Gabrb2 T C 11: 42,378,131 (GRCm39) W116R probably damaging Het
Galnt7 G A 8: 57,995,953 (GRCm39) A355V probably damaging Het
Klk1b5 T G 7: 43,867,962 (GRCm39) F45V probably benign Het
Nfkbiz T C 16: 55,636,750 (GRCm39) N517S probably damaging Het
Or10ak16 A G 4: 118,750,716 (GRCm39) I145M probably benign Het
Or10d5 T A 9: 39,861,713 (GRCm39) Y118F probably benign Het
P2rx1 T C 11: 72,904,715 (GRCm39) F368L probably damaging Het
Palld A T 8: 62,164,440 (GRCm39) V417E probably damaging Het
Robo1 C A 16: 72,821,385 (GRCm39) A1375E probably benign Het
Rps24 G T 14: 24,540,829 (GRCm39) probably benign Het
Serpind1 A G 16: 17,154,949 (GRCm39) N259D probably benign Het
Sh3bp4 C A 1: 89,073,037 (GRCm39) N628K probably benign Het
Tada3 A T 6: 113,351,774 (GRCm39) L177Q probably damaging Het
Tcam1 T A 11: 106,177,731 (GRCm39) L508Q probably damaging Het
Thbs1 T C 2: 117,946,359 (GRCm39) S360P possibly damaging Het
Tmem33 T C 5: 67,424,718 (GRCm39) probably benign Het
Vmn2r3 A G 3: 64,178,617 (GRCm39) probably benign Het
Vwa3b A G 1: 37,204,879 (GRCm39) E121G probably damaging Het
Zfp607b T A 7: 27,402,127 (GRCm39) H194Q probably damaging Het
Zfp729b G A 13: 67,740,696 (GRCm39) P523L probably damaging Het
Other mutations in Nav2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Nav2 APN 7 49,220,942 (GRCm39) missense probably damaging 1.00
IGL01150:Nav2 APN 7 49,102,269 (GRCm39) missense probably benign 0.17
IGL01649:Nav2 APN 7 49,225,477 (GRCm39) missense probably damaging 1.00
IGL01662:Nav2 APN 7 49,220,957 (GRCm39) missense probably damaging 1.00
IGL02297:Nav2 APN 7 49,243,977 (GRCm39) missense probably damaging 0.98
IGL02313:Nav2 APN 7 49,208,521 (GRCm39) missense probably damaging 0.99
IGL02441:Nav2 APN 7 49,102,260 (GRCm39) missense probably damaging 1.00
IGL02472:Nav2 APN 7 49,195,789 (GRCm39) missense probably damaging 1.00
IGL02477:Nav2 APN 7 49,232,623 (GRCm39) missense probably damaging 0.99
IGL02725:Nav2 APN 7 49,214,843 (GRCm39) missense probably damaging 1.00
IGL02944:Nav2 APN 7 49,070,004 (GRCm39) missense probably damaging 0.99
IGL02953:Nav2 APN 7 49,198,171 (GRCm39) missense probably damaging 1.00
IGL03105:Nav2 APN 7 49,114,627 (GRCm39) missense probably damaging 1.00
IGL03234:Nav2 APN 7 49,111,756 (GRCm39) missense possibly damaging 0.94
IGL03274:Nav2 APN 7 49,011,847 (GRCm39) missense probably damaging 1.00
IGL03294:Nav2 APN 7 49,141,205 (GRCm39) nonsense probably null
R0006:Nav2 UTSW 7 49,102,978 (GRCm39) missense possibly damaging 0.50
R0070:Nav2 UTSW 7 49,220,462 (GRCm39) missense probably damaging 1.00
R0113:Nav2 UTSW 7 49,185,701 (GRCm39) missense probably damaging 1.00
R0306:Nav2 UTSW 7 49,195,651 (GRCm39) missense probably benign 0.01
R0346:Nav2 UTSW 7 49,254,333 (GRCm39) missense probably benign 0.11
R0539:Nav2 UTSW 7 49,111,686 (GRCm39) missense probably damaging 1.00
R0669:Nav2 UTSW 7 49,058,431 (GRCm39) missense probably damaging 1.00
R0785:Nav2 UTSW 7 49,070,081 (GRCm39) missense probably benign 0.06
R0970:Nav2 UTSW 7 49,233,901 (GRCm39) missense probably damaging 1.00
R1162:Nav2 UTSW 7 49,185,788 (GRCm39) splice site probably benign
R1274:Nav2 UTSW 7 49,254,178 (GRCm39) nonsense probably null
R1463:Nav2 UTSW 7 49,185,710 (GRCm39) missense probably damaging 1.00
R1464:Nav2 UTSW 7 49,011,952 (GRCm39) missense probably damaging 1.00
R1464:Nav2 UTSW 7 49,011,952 (GRCm39) missense probably damaging 1.00
R1536:Nav2 UTSW 7 49,195,682 (GRCm39) missense probably damaging 1.00
R1612:Nav2 UTSW 7 49,220,959 (GRCm39) missense probably damaging 1.00
R1638:Nav2 UTSW 7 49,102,213 (GRCm39) missense probably benign
R1731:Nav2 UTSW 7 49,197,922 (GRCm39) missense probably damaging 1.00
R1734:Nav2 UTSW 7 49,225,468 (GRCm39) missense probably damaging 1.00
R1865:Nav2 UTSW 7 49,197,943 (GRCm39) missense possibly damaging 0.95
R1945:Nav2 UTSW 7 49,114,620 (GRCm39) missense probably damaging 1.00
R1997:Nav2 UTSW 7 49,198,219 (GRCm39) missense probably benign 0.16
R2061:Nav2 UTSW 7 49,248,645 (GRCm39) splice site probably benign
R2117:Nav2 UTSW 7 49,114,328 (GRCm39) missense probably benign 0.00
R2174:Nav2 UTSW 7 49,102,411 (GRCm39) missense probably damaging 0.99
R2182:Nav2 UTSW 7 49,247,002 (GRCm39) missense probably benign 0.38
R2251:Nav2 UTSW 7 49,103,025 (GRCm39) missense probably damaging 1.00
R2283:Nav2 UTSW 7 49,141,152 (GRCm39) missense probably damaging 1.00
R2343:Nav2 UTSW 7 49,248,565 (GRCm39) missense possibly damaging 0.82
R2472:Nav2 UTSW 7 49,058,632 (GRCm39) missense probably benign
R2568:Nav2 UTSW 7 49,247,312 (GRCm39) missense probably damaging 1.00
R2656:Nav2 UTSW 7 49,195,690 (GRCm39) missense probably damaging 1.00
R2964:Nav2 UTSW 7 49,206,780 (GRCm39) missense probably damaging 1.00
R2966:Nav2 UTSW 7 49,206,780 (GRCm39) missense probably damaging 1.00
R3817:Nav2 UTSW 7 49,114,310 (GRCm39) missense probably benign 0.00
R3834:Nav2 UTSW 7 49,195,606 (GRCm39) missense possibly damaging 0.91
R4207:Nav2 UTSW 7 49,246,979 (GRCm39) missense probably damaging 1.00
R4207:Nav2 UTSW 7 49,222,046 (GRCm39) splice site probably null
R4411:Nav2 UTSW 7 49,047,857 (GRCm39) missense probably benign 0.37
R4413:Nav2 UTSW 7 49,047,857 (GRCm39) missense probably benign 0.37
R4440:Nav2 UTSW 7 49,225,011 (GRCm39) splice site probably benign
R4440:Nav2 UTSW 7 49,201,785 (GRCm39) missense possibly damaging 0.86
R4454:Nav2 UTSW 7 49,198,292 (GRCm39) splice site probably null
R4729:Nav2 UTSW 7 49,102,567 (GRCm39) missense probably benign 0.17
R4801:Nav2 UTSW 7 49,195,600 (GRCm39) missense possibly damaging 0.94
R4802:Nav2 UTSW 7 49,195,600 (GRCm39) missense possibly damaging 0.94
R4824:Nav2 UTSW 7 49,058,749 (GRCm39) intron probably benign
R4887:Nav2 UTSW 7 49,198,182 (GRCm39) nonsense probably null
R4908:Nav2 UTSW 7 49,254,258 (GRCm39) missense probably damaging 1.00
R4952:Nav2 UTSW 7 48,954,288 (GRCm39) intron probably benign
R4965:Nav2 UTSW 7 49,202,625 (GRCm39) nonsense probably null
R5169:Nav2 UTSW 7 49,198,231 (GRCm39) nonsense probably null
R5224:Nav2 UTSW 7 49,201,473 (GRCm39) missense probably benign 0.00
R5249:Nav2 UTSW 7 49,185,661 (GRCm39) missense probably damaging 1.00
R5285:Nav2 UTSW 7 49,197,982 (GRCm39) missense probably damaging 1.00
R5314:Nav2 UTSW 7 49,058,440 (GRCm39) small deletion probably benign
R5320:Nav2 UTSW 7 49,141,121 (GRCm39) missense probably benign 0.00
R5377:Nav2 UTSW 7 49,238,908 (GRCm39) missense probably benign 0.02
R5471:Nav2 UTSW 7 49,197,917 (GRCm39) missense probably damaging 1.00
R5754:Nav2 UTSW 7 49,206,794 (GRCm39) missense probably damaging 1.00
R5832:Nav2 UTSW 7 49,197,817 (GRCm39) splice site probably null
R5884:Nav2 UTSW 7 49,246,917 (GRCm39) nonsense probably null
R5921:Nav2 UTSW 7 48,954,324 (GRCm39) intron probably benign
R6180:Nav2 UTSW 7 49,107,915 (GRCm39) missense probably benign 0.39
R6208:Nav2 UTSW 7 49,213,851 (GRCm39) missense probably damaging 0.99
R6373:Nav2 UTSW 7 49,102,923 (GRCm39) missense probably damaging 1.00
R6450:Nav2 UTSW 7 49,244,114 (GRCm39) missense probably damaging 1.00
R6522:Nav2 UTSW 7 49,247,281 (GRCm39) missense probably damaging 1.00
R6626:Nav2 UTSW 7 49,244,100 (GRCm39) missense probably damaging 1.00
R6695:Nav2 UTSW 7 49,114,652 (GRCm39) missense probably benign 0.04
R6705:Nav2 UTSW 7 49,201,664 (GRCm39) missense probably damaging 1.00
R6842:Nav2 UTSW 7 49,107,917 (GRCm39) missense possibly damaging 0.91
R6847:Nav2 UTSW 7 49,141,204 (GRCm39) missense probably benign 0.14
R7287:Nav2 UTSW 7 49,070,076 (GRCm39) missense probably benign 0.01
R7312:Nav2 UTSW 7 49,111,672 (GRCm39) missense possibly damaging 0.55
R7315:Nav2 UTSW 7 49,198,037 (GRCm39) missense possibly damaging 0.61
R7337:Nav2 UTSW 7 49,201,521 (GRCm39) missense possibly damaging 0.56
R7366:Nav2 UTSW 7 49,203,951 (GRCm39) splice site probably null
R7451:Nav2 UTSW 7 49,202,577 (GRCm39) splice site probably null
R7545:Nav2 UTSW 7 49,232,605 (GRCm39) missense probably damaging 1.00
R7706:Nav2 UTSW 7 49,244,067 (GRCm39) missense probably benign 0.35
R7730:Nav2 UTSW 7 49,222,145 (GRCm39) missense probably damaging 1.00
R7812:Nav2 UTSW 7 49,246,921 (GRCm39) missense probably benign 0.13
R8097:Nav2 UTSW 7 49,237,525 (GRCm39) missense probably damaging 1.00
R8110:Nav2 UTSW 7 49,201,698 (GRCm39) nonsense probably null
R8119:Nav2 UTSW 7 49,103,232 (GRCm39) missense probably damaging 0.99
R8298:Nav2 UTSW 7 49,204,009 (GRCm39) critical splice donor site probably null
R8306:Nav2 UTSW 7 49,195,765 (GRCm39) missense probably benign 0.33
R8331:Nav2 UTSW 7 49,102,371 (GRCm39) missense probably benign
R8421:Nav2 UTSW 7 49,102,269 (GRCm39) missense probably benign
R8478:Nav2 UTSW 7 49,111,733 (GRCm39) missense probably damaging 0.99
R8724:Nav2 UTSW 7 49,141,184 (GRCm39) missense possibly damaging 0.82
R8753:Nav2 UTSW 7 49,102,320 (GRCm39) missense probably benign
R8835:Nav2 UTSW 7 49,248,551 (GRCm39) missense possibly damaging 0.83
R8933:Nav2 UTSW 7 49,111,705 (GRCm39) missense probably damaging 1.00
R8957:Nav2 UTSW 7 49,220,964 (GRCm39) missense probably damaging 1.00
R9069:Nav2 UTSW 7 49,208,561 (GRCm39) missense probably damaging 0.99
R9095:Nav2 UTSW 7 49,254,293 (GRCm39) missense probably damaging 1.00
R9223:Nav2 UTSW 7 49,202,599 (GRCm39) missense probably damaging 1.00
R9261:Nav2 UTSW 7 49,246,904 (GRCm39) missense probably damaging 1.00
X0023:Nav2 UTSW 7 49,197,647 (GRCm39) missense possibly damaging 0.47
Z1177:Nav2 UTSW 7 49,243,971 (GRCm39) missense probably benign 0.01
Z1177:Nav2 UTSW 7 49,102,509 (GRCm39) missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- AGAACGTGTCTGCGAAGTCC -3'
(R):5'- GCCCCAGGCTAGAACTATGTATTG -3'

Sequencing Primer
(F):5'- TGTCTGCGAAGTCCCCAAGTG -3'
(R):5'- GGCTAGAACTATGTATTGCTTTAGC -3'
Posted On 2020-10-20