Incidental Mutation 'R8402:Palld'
ID 652236
Institutional Source Beutler Lab
Gene Symbol Palld
Ensembl Gene ENSMUSG00000058056
Gene Name palladin, cytoskeletal associated protein
Synonyms 2410003B16Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8402 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 61511433-61902690 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 61711406 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 417 (V417E)
Ref Sequence ENSEMBL: ENSMUSP00000112442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034057] [ENSMUST00000121493] [ENSMUST00000121785]
AlphaFold Q9ET54
Predicted Effect probably benign
Transcript: ENSMUST00000034057
AA Change: V417E

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034057
Gene: ENSMUSG00000058056
AA Change: V417E

DomainStartEndE-ValueType
IGc2 290 358 1.45e-9 SMART
low complexity region 372 385 N/A INTRINSIC
IGc2 460 535 1.6e-11 SMART
low complexity region 639 667 N/A INTRINSIC
IGc2 796 865 3.1e-9 SMART
low complexity region 881 906 N/A INTRINSIC
IGc2 930 998 4.92e-12 SMART
IGc2 1029 1098 1.61e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000121493
AA Change: V28E
SMART Domains Protein: ENSMUSP00000113874
Gene: ENSMUSG00000058056
AA Change: V28E

DomainStartEndE-ValueType
IGc2 71 146 1.6e-11 SMART
low complexity region 250 284 N/A INTRINSIC
low complexity region 298 326 N/A INTRINSIC
low complexity region 376 407 N/A INTRINSIC
low complexity region 416 451 N/A INTRINSIC
IGc2 632 701 3.1e-9 SMART
low complexity region 717 742 N/A INTRINSIC
IGc2 766 834 4.92e-12 SMART
IGc2 865 934 1.61e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121785
AA Change: V417E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112442
Gene: ENSMUSG00000058056
AA Change: V417E

DomainStartEndE-ValueType
IGc2 290 358 1.45e-9 SMART
low complexity region 372 385 N/A INTRINSIC
IGc2 460 535 1.6e-11 SMART
low complexity region 639 673 N/A INTRINSIC
low complexity region 687 715 N/A INTRINSIC
low complexity region 765 796 N/A INTRINSIC
low complexity region 805 840 N/A INTRINSIC
IGc2 1038 1107 3.1e-9 SMART
low complexity region 1123 1148 N/A INTRINSIC
IGc2 1172 1240 4.92e-12 SMART
IGc2 1271 1340 1.61e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is required for organizing the actin cytoskeleton. The protein is a component of actin-containing microfilaments, and it is involved in the control of cell shape, adhesion, and contraction. Polymorphisms in this gene are associated with a susceptibility to pancreatic cancer type 1, and also with a risk for myocardial infarction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: All homozygous null embryos die around E15.5 displaying exencephaly derived from neural tube closure defects, and herniation of the intestine and liver due to ventral closure defects. Mutant MEFs show impaired formation of actin stress fibers, reduced migration and decreased adhesion to fibronectin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,323,044 D157V possibly damaging Het
Adamts12 A T 15: 11,263,290 K579N probably damaging Het
Adcy7 T C 8: 88,308,735 V89A probably benign Het
Anapc1 G A 2: 128,630,228 S1458L probably benign Het
AW551984 T C 9: 39,597,653 Y325C probably damaging Het
Btnl4 T C 17: 34,469,493 Y437C probably damaging Het
Ccdc88a T A 11: 29,463,879 S806T probably damaging Het
Ddit4l A G 3: 137,626,127 T85A probably damaging Het
Dmxl1 G A 18: 49,878,326 W1183* probably null Het
Dmxl1 G C 18: 49,878,327 D1184H probably benign Het
Dmxl1 G T 18: 49,878,342 V1189L probably benign Het
Evpl T C 11: 116,225,371 D820G probably benign Het
Fam76b T C 9: 13,839,676 S289P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gabrb2 T C 11: 42,487,304 W116R probably damaging Het
Galnt7 G A 8: 57,542,919 A355V probably damaging Het
Klk1b5 T G 7: 44,218,538 F45V probably benign Het
Nav2 T C 7: 49,453,437 V661A probably benign Het
Nfkbiz T C 16: 55,816,387 N517S probably damaging Het
Olfr1330 A G 4: 118,893,519 I145M probably benign Het
Olfr975 T A 9: 39,950,417 Y118F probably benign Het
P2rx1 T C 11: 73,013,889 F368L probably damaging Het
Robo1 C A 16: 73,024,497 A1375E probably benign Het
Rps24 G T 14: 24,490,761 probably benign Het
Serpind1 A G 16: 17,337,085 N259D probably benign Het
Sh3bp4 C A 1: 89,145,315 N628K probably benign Het
Tada3 A T 6: 113,374,813 L177Q probably damaging Het
Tcam1 T A 11: 106,286,905 L508Q probably damaging Het
Thbs1 T C 2: 118,115,878 S360P possibly damaging Het
Tmem33 T C 5: 67,267,375 probably benign Het
Vmn2r3 A G 3: 64,271,196 probably benign Het
Vwa3b A G 1: 37,165,798 E121G probably damaging Het
Zfp607b T A 7: 27,702,702 H194Q probably damaging Het
Zfp729b G A 13: 67,592,577 P523L probably damaging Het
Other mutations in Palld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Palld APN 8 61515935 missense possibly damaging 0.77
IGL01083:Palld APN 8 61538807 missense probably benign 0.44
IGL01644:Palld APN 8 61877478 missense probably benign 0.28
IGL01672:Palld APN 8 61877502 missense probably benign 0.22
IGL01941:Palld APN 8 61535700 missense probably benign 0.44
IGL02037:Palld APN 8 61525114 missense probably damaging 1.00
IGL02126:Palld APN 8 61877442 missense possibly damaging 0.82
IGL02537:Palld APN 8 61684934 missense probably benign 0.05
IGL02632:Palld APN 8 61515245 missense probably damaging 1.00
IGL02809:Palld APN 8 61515247 missense probably damaging 1.00
IGL02901:Palld APN 8 61876995 nonsense probably null
IGL03400:Palld APN 8 61513455 missense probably damaging 1.00
R0098:Palld UTSW 8 61525086 missense probably damaging 1.00
R0098:Palld UTSW 8 61525086 missense probably damaging 1.00
R0745:Palld UTSW 8 61877703 missense probably damaging 1.00
R1263:Palld UTSW 8 61513457 frame shift probably null
R1342:Palld UTSW 8 61522882 critical splice donor site probably null
R1893:Palld UTSW 8 61516621 missense probably damaging 1.00
R2017:Palld UTSW 8 61684765 missense probably damaging 0.99
R2102:Palld UTSW 8 61533433 missense possibly damaging 0.82
R2129:Palld UTSW 8 61877361 missense probably benign 0.00
R2246:Palld UTSW 8 61877135 missense probably benign 0.01
R3545:Palld UTSW 8 61550078 missense possibly damaging 0.95
R3815:Palld UTSW 8 61549837 intron probably benign
R3824:Palld UTSW 8 61709033 missense probably damaging 1.00
R4412:Palld UTSW 8 61687372 missense probably damaging 0.98
R4781:Palld UTSW 8 61877028 missense probably benign 0.01
R4836:Palld UTSW 8 61687381 missense probably benign 0.11
R4871:Palld UTSW 8 61549781 intron probably benign
R4963:Palld UTSW 8 61703210 missense probably damaging 1.00
R5036:Palld UTSW 8 61550162 missense probably damaging 1.00
R5128:Palld UTSW 8 61720588 missense probably damaging 1.00
R5343:Palld UTSW 8 61549815 intron probably benign
R5421:Palld UTSW 8 61516550 missense probably damaging 1.00
R5427:Palld UTSW 8 61550072 missense probably benign 0.01
R5561:Palld UTSW 8 61516585 missense probably damaging 1.00
R5651:Palld UTSW 8 61538788 missense probably damaging 1.00
R5679:Palld UTSW 8 61684945 missense possibly damaging 0.95
R5915:Palld UTSW 8 61533352 critical splice donor site probably null
R6153:Palld UTSW 8 61550152 missense probably damaging 1.00
R6276:Palld UTSW 8 61513423 missense probably damaging 1.00
R6323:Palld UTSW 8 61720693 missense probably damaging 1.00
R6659:Palld UTSW 8 61533443 missense probably benign 0.28
R7016:Palld UTSW 8 61515998 missense probably damaging 1.00
R7124:Palld UTSW 8 61516645 missense unknown
R7145:Palld UTSW 8 61532017 missense unknown
R7386:Palld UTSW 8 61532052 missense unknown
R7407:Palld UTSW 8 61515941 nonsense probably null
R7723:Palld UTSW 8 61711458 missense probably damaging 1.00
R8029:Palld UTSW 8 61877312 missense probably damaging 1.00
R8775:Palld UTSW 8 61684972 missense possibly damaging 0.73
R8775-TAIL:Palld UTSW 8 61684972 missense possibly damaging 0.73
R8887:Palld UTSW 8 61533478 missense unknown
R8906:Palld UTSW 8 61550164 critical splice donor site probably null
R8969:Palld UTSW 8 61684849 missense probably damaging 1.00
R8971:Palld UTSW 8 61516701 missense unknown
R8990:Palld UTSW 8 61515245 missense probably damaging 1.00
R9012:Palld UTSW 8 61720663 missense possibly damaging 0.85
R9145:Palld UTSW 8 61877073 missense probably benign 0.01
R9221:Palld UTSW 8 61516557 missense unknown
R9228:Palld UTSW 8 61720537 missense probably damaging 1.00
R9311:Palld UTSW 8 61525155 missense unknown
R9355:Palld UTSW 8 61516657 missense unknown
R9376:Palld UTSW 8 61516657 missense unknown
R9377:Palld UTSW 8 61516657 missense unknown
R9378:Palld UTSW 8 61516657 missense unknown
R9467:Palld UTSW 8 61515230 missense unknown
R9638:Palld UTSW 8 61549754 missense unknown
Predicted Primers PCR Primer
(F):5'- AATTCCTATTTGAGCTTGGCTG -3'
(R):5'- CCACACAGCTCTTTTGGCAG -3'

Sequencing Primer
(F):5'- AGCTTGGCTGGTGACTTCC -3'
(R):5'- ATTTTAATGGAAGTAGACCGGGTC -3'
Posted On 2020-10-20