Incidental Mutation 'R8402:AW551984'
ID 652239
Institutional Source Beutler Lab
Gene Symbol AW551984
Ensembl Gene ENSMUSG00000038112
Gene Name expressed sequence AW551984
Synonyms
MMRRC Submission 067878-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8402 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 39498692-39515699 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 39508949 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 325 (Y325C)
Ref Sequence ENSEMBL: ENSMUSP00000042582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042485] [ENSMUST00000119722] [ENSMUST00000130829] [ENSMUST00000141370]
AlphaFold Q8BGF0
Predicted Effect probably damaging
Transcript: ENSMUST00000042485
AA Change: Y325C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042582
Gene: ENSMUSG00000038112
AA Change: Y325C

DomainStartEndE-ValueType
VIT 1 131 1.59e-47 SMART
VWA 279 460 1.04e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119722
AA Change: Y325C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113212
Gene: ENSMUSG00000038112
AA Change: Y325C

DomainStartEndE-ValueType
VIT 1 131 1.59e-47 SMART
VWA 279 460 1.04e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130829
SMART Domains Protein: ENSMUSP00000117262
Gene: ENSMUSG00000038112

DomainStartEndE-ValueType
Pfam:VIT_2 5 52 1.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141370
SMART Domains Protein: ENSMUSP00000117328
Gene: ENSMUSG00000038112

DomainStartEndE-ValueType
VIT 1 131 1.59e-47 SMART
Meta Mutation Damage Score 0.7158 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A T 15: 11,263,376 (GRCm39) K579N probably damaging Het
Adcy7 T C 8: 89,035,363 (GRCm39) V89A probably benign Het
Anapc1 G A 2: 128,472,148 (GRCm39) S1458L probably benign Het
Btnl4 T C 17: 34,688,467 (GRCm39) Y437C probably damaging Het
Ccdc88a T A 11: 29,413,879 (GRCm39) S806T probably damaging Het
Clec2m T A 6: 129,300,007 (GRCm39) D157V possibly damaging Het
Ddit4l A G 3: 137,331,888 (GRCm39) T85A probably damaging Het
Dmxl1 G A 18: 50,011,393 (GRCm39) W1183* probably null Het
Dmxl1 G T 18: 50,011,409 (GRCm39) V1189L probably benign Het
Dmxl1 G C 18: 50,011,394 (GRCm39) D1184H probably benign Het
Evpl T C 11: 116,116,197 (GRCm39) D820G probably benign Het
Fam76b T C 9: 13,750,972 (GRCm39) S289P probably damaging Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Gabrb2 T C 11: 42,378,131 (GRCm39) W116R probably damaging Het
Galnt7 G A 8: 57,995,953 (GRCm39) A355V probably damaging Het
Klk1b5 T G 7: 43,867,962 (GRCm39) F45V probably benign Het
Nav2 T C 7: 49,103,185 (GRCm39) V661A probably benign Het
Nfkbiz T C 16: 55,636,750 (GRCm39) N517S probably damaging Het
Or10ak16 A G 4: 118,750,716 (GRCm39) I145M probably benign Het
Or10d5 T A 9: 39,861,713 (GRCm39) Y118F probably benign Het
P2rx1 T C 11: 72,904,715 (GRCm39) F368L probably damaging Het
Palld A T 8: 62,164,440 (GRCm39) V417E probably damaging Het
Robo1 C A 16: 72,821,385 (GRCm39) A1375E probably benign Het
Rps24 G T 14: 24,540,829 (GRCm39) probably benign Het
Serpind1 A G 16: 17,154,949 (GRCm39) N259D probably benign Het
Sh3bp4 C A 1: 89,073,037 (GRCm39) N628K probably benign Het
Tada3 A T 6: 113,351,774 (GRCm39) L177Q probably damaging Het
Tcam1 T A 11: 106,177,731 (GRCm39) L508Q probably damaging Het
Thbs1 T C 2: 117,946,359 (GRCm39) S360P possibly damaging Het
Tmem33 T C 5: 67,424,718 (GRCm39) probably benign Het
Vmn2r3 A G 3: 64,178,617 (GRCm39) probably benign Het
Vwa3b A G 1: 37,204,879 (GRCm39) E121G probably damaging Het
Zfp607b T A 7: 27,402,127 (GRCm39) H194Q probably damaging Het
Zfp729b G A 13: 67,740,696 (GRCm39) P523L probably damaging Het
Other mutations in AW551984
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:AW551984 APN 9 39,504,145 (GRCm39) missense probably benign 0.16
IGL00869:AW551984 APN 9 39,504,730 (GRCm39) splice site probably benign
IGL01411:AW551984 APN 9 39,505,087 (GRCm39) missense possibly damaging 0.69
IGL01744:AW551984 APN 9 39,502,568 (GRCm39) missense probably benign 0.01
IGL02102:AW551984 APN 9 39,500,987 (GRCm39) missense probably damaging 1.00
IGL02149:AW551984 APN 9 39,504,220 (GRCm39) missense probably benign 0.06
IGL02151:AW551984 APN 9 39,504,241 (GRCm39) missense probably benign 0.35
IGL02154:AW551984 APN 9 39,500,398 (GRCm39) missense possibly damaging 0.93
IGL02158:AW551984 APN 9 39,510,621 (GRCm39) missense probably null 0.99
IGL02574:AW551984 APN 9 39,500,382 (GRCm39) missense possibly damaging 0.91
IGL02754:AW551984 APN 9 39,504,624 (GRCm39) critical splice donor site probably null
IGL02754:AW551984 APN 9 39,507,922 (GRCm39) nonsense probably null
IGL02838:AW551984 APN 9 39,505,939 (GRCm39) missense probably damaging 1.00
IGL03240:AW551984 APN 9 39,500,418 (GRCm39) missense probably benign 0.00
IGL03328:AW551984 APN 9 39,508,412 (GRCm39) missense probably damaging 1.00
IGL03374:AW551984 APN 9 39,511,062 (GRCm39) missense possibly damaging 0.52
PIT4260001:AW551984 UTSW 9 39,504,275 (GRCm39) missense probably benign 0.08
R0141:AW551984 UTSW 9 39,501,940 (GRCm39) missense probably damaging 1.00
R0269:AW551984 UTSW 9 39,511,246 (GRCm39) missense probably damaging 1.00
R0365:AW551984 UTSW 9 39,510,617 (GRCm39) missense probably benign 0.14
R0453:AW551984 UTSW 9 39,511,937 (GRCm39) missense probably damaging 1.00
R0481:AW551984 UTSW 9 39,511,912 (GRCm39) missense probably null 1.00
R1005:AW551984 UTSW 9 39,505,029 (GRCm39) nonsense probably null
R1585:AW551984 UTSW 9 39,510,632 (GRCm39) nonsense probably null
R2177:AW551984 UTSW 9 39,511,111 (GRCm39) missense probably benign
R3117:AW551984 UTSW 9 39,504,656 (GRCm39) missense probably benign 0.08
R3119:AW551984 UTSW 9 39,504,656 (GRCm39) missense probably benign 0.08
R3162:AW551984 UTSW 9 39,504,325 (GRCm39) missense probably damaging 1.00
R3162:AW551984 UTSW 9 39,504,325 (GRCm39) missense probably damaging 1.00
R3836:AW551984 UTSW 9 39,509,204 (GRCm39) unclassified probably benign
R3837:AW551984 UTSW 9 39,509,204 (GRCm39) unclassified probably benign
R3839:AW551984 UTSW 9 39,509,204 (GRCm39) unclassified probably benign
R4299:AW551984 UTSW 9 39,504,275 (GRCm39) missense probably benign 0.08
R4422:AW551984 UTSW 9 39,511,373 (GRCm39) missense probably null 0.00
R4713:AW551984 UTSW 9 39,508,449 (GRCm39) missense probably benign 0.13
R4905:AW551984 UTSW 9 39,508,454 (GRCm39) missense probably damaging 0.99
R4966:AW551984 UTSW 9 39,508,472 (GRCm39) missense possibly damaging 0.92
R5022:AW551984 UTSW 9 39,509,261 (GRCm39) missense probably benign 0.00
R5041:AW551984 UTSW 9 39,511,894 (GRCm39) missense probably damaging 1.00
R5342:AW551984 UTSW 9 39,505,847 (GRCm39) missense probably damaging 1.00
R5383:AW551984 UTSW 9 39,501,994 (GRCm39) missense probably benign
R5443:AW551984 UTSW 9 39,509,325 (GRCm39) missense possibly damaging 0.94
R5532:AW551984 UTSW 9 39,508,481 (GRCm39) missense probably damaging 1.00
R5536:AW551984 UTSW 9 39,504,169 (GRCm39) missense probably benign 0.04
R5586:AW551984 UTSW 9 39,502,559 (GRCm39) missense probably benign 0.01
R5601:AW551984 UTSW 9 39,502,563 (GRCm39) missense possibly damaging 0.87
R5618:AW551984 UTSW 9 39,502,000 (GRCm39) missense probably damaging 1.00
R5701:AW551984 UTSW 9 39,504,118 (GRCm39) missense probably benign 0.01
R6122:AW551984 UTSW 9 39,505,051 (GRCm39) missense probably benign 0.00
R6142:AW551984 UTSW 9 39,508,410 (GRCm39) missense probably benign 0.00
R6272:AW551984 UTSW 9 39,509,333 (GRCm39) missense probably benign 0.06
R6429:AW551984 UTSW 9 39,511,910 (GRCm39) missense probably damaging 1.00
R6659:AW551984 UTSW 9 39,500,395 (GRCm39) missense probably benign 0.00
R6670:AW551984 UTSW 9 39,504,292 (GRCm39) missense probably damaging 1.00
R6791:AW551984 UTSW 9 39,511,955 (GRCm39) missense probably damaging 1.00
R7000:AW551984 UTSW 9 39,512,085 (GRCm39) missense probably benign 0.11
R7077:AW551984 UTSW 9 39,502,723 (GRCm39) missense probably benign
R7083:AW551984 UTSW 9 39,508,943 (GRCm39) missense probably damaging 1.00
R7352:AW551984 UTSW 9 39,504,221 (GRCm39) missense probably benign
R7475:AW551984 UTSW 9 39,509,236 (GRCm39) missense probably damaging 1.00
R7534:AW551984 UTSW 9 39,502,777 (GRCm39) missense probably benign 0.03
R7542:AW551984 UTSW 9 39,505,927 (GRCm39) missense possibly damaging 0.95
R7708:AW551984 UTSW 9 39,505,051 (GRCm39) missense probably benign 0.00
R7729:AW551984 UTSW 9 39,511,071 (GRCm39) missense possibly damaging 0.89
R7955:AW551984 UTSW 9 39,507,960 (GRCm39) missense probably damaging 1.00
R8122:AW551984 UTSW 9 39,510,665 (GRCm39) missense probably damaging 1.00
R8358:AW551984 UTSW 9 39,510,651 (GRCm39) missense probably damaging 0.99
R8683:AW551984 UTSW 9 39,511,005 (GRCm39) missense possibly damaging 0.86
R8810:AW551984 UTSW 9 39,511,307 (GRCm39) missense probably damaging 1.00
R8857:AW551984 UTSW 9 39,511,831 (GRCm39) missense probably damaging 1.00
R8871:AW551984 UTSW 9 39,500,998 (GRCm39) nonsense probably null
R9019:AW551984 UTSW 9 39,508,973 (GRCm39) nonsense probably null
Z1088:AW551984 UTSW 9 39,501,899 (GRCm39) nonsense probably null
ZE80:AW551984 UTSW 9 39,504,963 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- GGTCAGCTTTACACCTACCC -3'
(R):5'- CTTGGGGTTTCCTTAGAGTACAAG -3'

Sequencing Primer
(F):5'- TGTGTGATAGCTACCTGTGAAAG -3'
(R):5'- GATGGAATAAAGTAGTGTGACAGACC -3'
Posted On 2020-10-20