Incidental Mutation 'R8402:Olfr975'
ID 652240
Institutional Source Beutler Lab
Gene Symbol Olfr975
Ensembl Gene ENSMUSG00000043331
Gene Name olfactory receptor 975
Synonyms MOR224-2, GA_x6K02T2PVTD-33651220-33650288
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R8402 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 39948131-39952046 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 39950417 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 118 (Y118F)
Ref Sequence ENSEMBL: ENSMUSP00000150664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054067] [ENSMUST00000169307] [ENSMUST00000213171] [ENSMUST00000216647] [ENSMUST00000217630]
AlphaFold Q8VG91
Predicted Effect probably benign
Transcript: ENSMUST00000054067
AA Change: Y118F

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000059776
Gene: ENSMUSG00000043331
AA Change: Y118F

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.9e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 249 1.8e-7 PFAM
Pfam:7tm_1 39 286 3.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169307
SMART Domains Protein: ENSMUSP00000133083
Gene: ENSMUSG00000047352

DomainStartEndE-ValueType
Pfam:7tm_4 43 318 1.5e-48 PFAM
Pfam:7TM_GPCR_Srsx 47 271 1.1e-5 PFAM
Pfam:7tm_1 53 300 2.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213171
Predicted Effect probably benign
Transcript: ENSMUST00000216647
AA Change: Y118F

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000217630
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,323,044 D157V possibly damaging Het
Adamts12 A T 15: 11,263,290 K579N probably damaging Het
Adcy7 T C 8: 88,308,735 V89A probably benign Het
Anapc1 G A 2: 128,630,228 S1458L probably benign Het
AW551984 T C 9: 39,597,653 Y325C probably damaging Het
Btnl4 T C 17: 34,469,493 Y437C probably damaging Het
Ccdc88a T A 11: 29,463,879 S806T probably damaging Het
Ddit4l A G 3: 137,626,127 T85A probably damaging Het
Dmxl1 G A 18: 49,878,326 W1183* probably null Het
Dmxl1 G C 18: 49,878,327 D1184H probably benign Het
Dmxl1 G T 18: 49,878,342 V1189L probably benign Het
Evpl T C 11: 116,225,371 D820G probably benign Het
Fam76b T C 9: 13,839,676 S289P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gabrb2 T C 11: 42,487,304 W116R probably damaging Het
Galnt7 G A 8: 57,542,919 A355V probably damaging Het
Klk1b5 T G 7: 44,218,538 F45V probably benign Het
Nav2 T C 7: 49,453,437 V661A probably benign Het
Nfkbiz T C 16: 55,816,387 N517S probably damaging Het
Olfr1330 A G 4: 118,893,519 I145M probably benign Het
P2rx1 T C 11: 73,013,889 F368L probably damaging Het
Palld A T 8: 61,711,406 V417E probably damaging Het
Robo1 C A 16: 73,024,497 A1375E probably benign Het
Rps24 G T 14: 24,490,761 probably benign Het
Serpind1 A G 16: 17,337,085 N259D probably benign Het
Sh3bp4 C A 1: 89,145,315 N628K probably benign Het
Tada3 A T 6: 113,374,813 L177Q probably damaging Het
Tcam1 T A 11: 106,286,905 L508Q probably damaging Het
Thbs1 T C 2: 118,115,878 S360P possibly damaging Het
Tmem33 T C 5: 67,267,375 probably benign Het
Vmn2r3 A G 3: 64,271,196 probably benign Het
Vwa3b A G 1: 37,165,798 E121G probably damaging Het
Zfp607b T A 7: 27,702,702 H194Q probably damaging Het
Zfp729b G A 13: 67,592,577 P523L probably damaging Het
Other mutations in Olfr975
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Olfr975 APN 9 39949988 missense probably benign 0.01
IGL01537:Olfr975 APN 9 39950625 missense probably benign 0.00
IGL01963:Olfr975 APN 9 39950240 missense probably damaging 1.00
IGL02400:Olfr975 APN 9 39950339 missense probably benign
IGL03115:Olfr975 APN 9 39950744 missense probably damaging 0.98
IGL03226:Olfr975 APN 9 39950423 splice site probably null
R0088:Olfr975 UTSW 9 39950375 missense probably benign 0.03
R0212:Olfr975 UTSW 9 39949940 missense probably benign 0.44
R1668:Olfr975 UTSW 9 39950169 missense possibly damaging 0.94
R1878:Olfr975 UTSW 9 39950757 missense probably benign 0.35
R2225:Olfr975 UTSW 9 39950537 missense possibly damaging 0.84
R2291:Olfr975 UTSW 9 39950334 missense probably benign 0.19
R2420:Olfr975 UTSW 9 39950528 missense possibly damaging 0.47
R2421:Olfr975 UTSW 9 39950528 missense possibly damaging 0.47
R2422:Olfr975 UTSW 9 39950528 missense possibly damaging 0.47
R2425:Olfr975 UTSW 9 39949841 missense probably null 0.25
R2918:Olfr975 UTSW 9 39950364 missense probably benign
R4536:Olfr975 UTSW 9 39950435 missense probably damaging 1.00
R4709:Olfr975 UTSW 9 39949869 missense probably damaging 0.97
R4831:Olfr975 UTSW 9 39950112 missense probably benign 0.01
R4921:Olfr975 UTSW 9 39950225 missense probably damaging 0.98
R5113:Olfr975 UTSW 9 39949925 missense probably damaging 0.99
R5141:Olfr975 UTSW 9 39949874 missense probably benign 0.07
R5195:Olfr975 UTSW 9 39950679 missense probably benign
R5213:Olfr975 UTSW 9 39950093 missense probably damaging 0.99
R5568:Olfr975 UTSW 9 39950687 missense probably benign 0.05
R6993:Olfr975 UTSW 9 39950637 missense probably benign
R7080:Olfr975 UTSW 9 39950148 missense probably damaging 1.00
R7436:Olfr975 UTSW 9 39950053 nonsense probably null
R8178:Olfr975 UTSW 9 39950412 missense probably benign 0.05
R8179:Olfr975 UTSW 9 39950412 missense probably benign 0.05
R8382:Olfr975 UTSW 9 39950159 missense probably benign 0.21
R8511:Olfr975 UTSW 9 39950159 missense probably benign 0.21
R8798:Olfr975 UTSW 9 39950717 missense probably benign 0.40
R9068:Olfr975 UTSW 9 39950791 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAGTTATCCACTTCATTGGGTCC -3'
(R):5'- ACTCATTCTGATGGCCATCC -3'

Sequencing Primer
(F):5'- CACTTCATTGGGTCCACAGTAGG -3'
(R):5'- GATGGCCATCCTGACTTCCG -3'
Posted On 2020-10-20