Mutagenetix > Incidental Mutation

Incidental Mutation 'R8402:Ccdc88a'

652241

Institutional Source

Beutler Lab

Gene Symbol

Ccdc88a

Ensembl Gene

ENSMUSG00000032740

Gene Name

coiled coil domain containing 88A

Synonyms

Girdin, GIV, A430106J12Rik, D130005J21Rik, HkRP1, C130096N06Rik, C330012F17Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8402 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

29373658-29510808 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 29463879 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 806 (S806T)

Ref Sequence

ENSEMBL: ENSMUSP00000048978 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040182] [ENSMUST00000155854]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000040182
AA Change: S806T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000048978
Gene: ENSMUSG00000032740
AA Change: S806T

Domain	Start	End	E-Value	Type
Pfam:HOOK	14	590	8.1e-36	PFAM
low complexity region	614	625	N/A	INTRINSIC
Blast:BRLZ	665	719	6e-22	BLAST
low complexity region	826	839	N/A	INTRINSIC
low complexity region	883	895	N/A	INTRINSIC
low complexity region	955	985	N/A	INTRINSIC
low complexity region	1093	1104	N/A	INTRINSIC
coiled coil region	1268	1385	N/A	INTRINSIC
low complexity region	1437	1444	N/A	INTRINSIC
low complexity region	1566	1576	N/A	INTRINSIC
internal_repeat_1	1609	1702	2.38e-6	PROSPERO
internal_repeat_1	1708	1808	2.38e-6	PROSPERO
low complexity region	1811	1824	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000155854

SMART Domains

Protein: ENSMUSP00000115117
Gene: ENSMUSG00000032740

Domain	Start	End	E-Value	Type
low complexity region	18	31	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	146	176	N/A	INTRINSIC
Blast:BRLZ	228	283	7e-6	BLAST
low complexity region	284	295	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Girdin family of coiled-coil domain containing proteins. The encoded protein is an actin-binding protein that is activated by the serine/threonine kinase Akt and plays a role in cytoskeleton remodeling and cell migration. The encoded protein also enhances Akt signaling by mediating phosphoinositide 3-kinase (PI3K)-dependent activation of Akt by growth factor receptor tyrosine kinases and G protein-coupled receptors. Increased expression of this gene and phosphorylation of the encoded protein may play a role in cancer metastasis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal weight loss, reduced angiogenesis, and premature death by P25. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	T	A	6: 129,323,044	D157V	possibly damaging	Het
Adamts12	A	T	15: 11,263,290	K579N	probably damaging	Het
Adcy7	T	C	8: 88,308,735	V89A	probably benign	Het
Anapc1	G	A	2: 128,630,228	S1458L	probably benign	Het
AW551984	T	C	9: 39,597,653	Y325C	probably damaging	Het
Btnl4	T	C	17: 34,469,493	Y437C	probably damaging	Het
Ddit4l	A	G	3: 137,626,127	T85A	probably damaging	Het
Dmxl1	G	A	18: 49,878,326	W1183*	probably null	Het
Dmxl1	G	C	18: 49,878,327	D1184H	probably benign	Het
Dmxl1	G	T	18: 49,878,342	V1189L	probably benign	Het
Evpl	T	C	11: 116,225,371	D820G	probably benign	Het
Fam76b	T	C	9: 13,839,676	S289P	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Gabrb2	T	C	11: 42,487,304	W116R	probably damaging	Het
Galnt7	G	A	8: 57,542,919	A355V	probably damaging	Het
Klk1b5	T	G	7: 44,218,538	F45V	probably benign	Het
Nav2	T	C	7: 49,453,437	V661A	probably benign	Het
Nfkbiz	T	C	16: 55,816,387	N517S	probably damaging	Het
Olfr1330	A	G	4: 118,893,519	I145M	probably benign	Het
Olfr975	T	A	9: 39,950,417	Y118F	probably benign	Het
P2rx1	T	C	11: 73,013,889	F368L	probably damaging	Het
Palld	A	T	8: 61,711,406	V417E	probably damaging	Het
Robo1	C	A	16: 73,024,497	A1375E	probably benign	Het
Rps24	G	T	14: 24,490,761		probably benign	Het
Serpind1	A	G	16: 17,337,085	N259D	probably benign	Het
Sh3bp4	C	A	1: 89,145,315	N628K	probably benign	Het
Tada3	A	T	6: 113,374,813	L177Q	probably damaging	Het
Tcam1	T	A	11: 106,286,905	L508Q	probably damaging	Het
Thbs1	T	C	2: 118,115,878	S360P	possibly damaging	Het
Tmem33	T	C	5: 67,267,375		probably benign	Het
Vmn2r3	A	G	3: 64,271,196		probably benign	Het
Vwa3b	A	G	1: 37,165,798	E121G	probably damaging	Het
Zfp607b	T	A	7: 27,702,702	H194Q	probably damaging	Het
Zfp729b	G	A	13: 67,592,577	P523L	probably damaging	Het

Other mutations in Ccdc88a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Ccdc88a	APN	11	29499341	missense	probably benign	0.24
IGL00577:Ccdc88a	APN	11	29424772	missense	probably damaging	1.00
IGL00766:Ccdc88a	APN	11	29501046	missense	probably damaging	0.99
IGL01384:Ccdc88a	APN	11	29503915	missense	probably damaging	0.99
IGL01541:Ccdc88a	APN	11	29400283	missense	probably benign
IGL01647:Ccdc88a	APN	11	29504321	unclassified	probably benign
IGL02648:Ccdc88a	APN	11	29501051	missense	probably benign	0.28
IGL02885:Ccdc88a	APN	11	29448050	missense	probably damaging	1.00
IGL03117:Ccdc88a	APN	11	29374559	missense	probably damaging	1.00
IGL03196:Ccdc88a	APN	11	29482340	missense	possibly damaging	0.56
trailor	UTSW	11	29494099	splice site	probably null
R0011:Ccdc88a	UTSW	11	29374364	missense	probably damaging	1.00
R0011:Ccdc88a	UTSW	11	29374364	missense	probably damaging	1.00
R0083:Ccdc88a	UTSW	11	29503463	missense	probably damaging	0.99
R0108:Ccdc88a	UTSW	11	29503463	missense	probably damaging	0.99
R0326:Ccdc88a	UTSW	11	29461021	missense	probably benign	0.01
R0565:Ccdc88a	UTSW	11	29461042	unclassified	probably benign
R0631:Ccdc88a	UTSW	11	29493752	missense	probably damaging	0.98
R0632:Ccdc88a	UTSW	11	29482749	unclassified	probably benign
R0762:Ccdc88a	UTSW	11	29463112	unclassified	probably benign
R0838:Ccdc88a	UTSW	11	29400285	missense	probably damaging	1.00
R0946:Ccdc88a	UTSW	11	29456509	missense	probably benign
R1192:Ccdc88a	UTSW	11	29504049	missense	possibly damaging	0.45
R1500:Ccdc88a	UTSW	11	29482713	missense	probably benign	0.00
R1701:Ccdc88a	UTSW	11	29477427	missense	possibly damaging	0.59
R1826:Ccdc88a	UTSW	11	29489637	missense	possibly damaging	0.58
R1902:Ccdc88a	UTSW	11	29461788	missense	probably benign	0.07
R1903:Ccdc88a	UTSW	11	29461788	missense	probably benign	0.07
R2021:Ccdc88a	UTSW	11	29503480	missense	probably damaging	1.00
R2023:Ccdc88a	UTSW	11	29463546	nonsense	probably null
R2284:Ccdc88a	UTSW	11	29494099	splice site	probably null
R3236:Ccdc88a	UTSW	11	29447995	missense	possibly damaging	0.51
R3409:Ccdc88a	UTSW	11	29486006	missense	probably damaging	1.00
R3410:Ccdc88a	UTSW	11	29486006	missense	probably damaging	1.00
R3411:Ccdc88a	UTSW	11	29486006	missense	probably damaging	1.00
R3430:Ccdc88a	UTSW	11	29448033	missense	probably damaging	0.98
R3620:Ccdc88a	UTSW	11	29430227	missense	probably benign	0.16
R4204:Ccdc88a	UTSW	11	29463399	missense	probably damaging	1.00
R4515:Ccdc88a	UTSW	11	29482651	missense	probably benign	0.01
R4518:Ccdc88a	UTSW	11	29482651	missense	probably benign	0.01
R4519:Ccdc88a	UTSW	11	29482651	missense	probably benign	0.01
R4693:Ccdc88a	UTSW	11	29482241	missense	probably damaging	1.00
R4705:Ccdc88a	UTSW	11	29422586	missense	probably benign
R4707:Ccdc88a	UTSW	11	29447956	missense	probably benign
R4732:Ccdc88a	UTSW	11	29485906	missense	probably benign	0.02
R4733:Ccdc88a	UTSW	11	29485906	missense	probably benign	0.02
R4734:Ccdc88a	UTSW	11	29482720	missense	probably benign
R4749:Ccdc88a	UTSW	11	29482720	missense	probably benign
R4817:Ccdc88a	UTSW	11	29460907	missense	probably benign	0.15
R4828:Ccdc88a	UTSW	11	29463210	missense	probably damaging	1.00
R4979:Ccdc88a	UTSW	11	29482133	nonsense	probably null
R5288:Ccdc88a	UTSW	11	29498416	missense	possibly damaging	0.77
R5373:Ccdc88a	UTSW	11	29463409	missense	possibly damaging	0.92
R5374:Ccdc88a	UTSW	11	29463409	missense	possibly damaging	0.92
R5401:Ccdc88a	UTSW	11	29463279	missense	probably benign	0.00
R5586:Ccdc88a	UTSW	11	29503484	missense	probably benign	0.00
R6660:Ccdc88a	UTSW	11	29482663	missense	probably benign	0.01
R7116:Ccdc88a	UTSW	11	29504051	missense	probably benign	0.01
R7353:Ccdc88a	UTSW	11	29463368	missense	probably benign	0.00
R7538:Ccdc88a	UTSW	11	29463370	missense	probably benign	0.00
R7663:Ccdc88a	UTSW	11	29498614	critical splice donor site	probably null
R7769:Ccdc88a	UTSW	11	29482381	missense	probably damaging	1.00
R7798:Ccdc88a	UTSW	11	29477348	missense	probably benign	0.15
R7810:Ccdc88a	UTSW	11	29485964	missense	probably damaging	1.00
R7826:Ccdc88a	UTSW	11	29503563	missense	probably benign	0.02
R7956:Ccdc88a	UTSW	11	29463892	missense	probably damaging	1.00
R8260:Ccdc88a	UTSW	11	29493934	missense	probably benign	0.01
R8409:Ccdc88a	UTSW	11	29503544	missense	probably benign
R8555:Ccdc88a	UTSW	11	29430169	missense	probably benign
R8676:Ccdc88a	UTSW	11	29460860	missense	probably benign	0.05
R8846:Ccdc88a	UTSW	11	29464185	missense	probably damaging	1.00
R8963:Ccdc88a	UTSW	11	29498416	missense	possibly damaging	0.77
R8972:Ccdc88a	UTSW	11	29485888	missense	probably benign	0.07
R9353:Ccdc88a	UTSW	11	29477433	missense	probably damaging	1.00
R9362:Ccdc88a	UTSW	11	29503922	missense	probably null	0.55
R9385:Ccdc88a	UTSW	11	29455422	missense	probably benign	0.24
R9509:Ccdc88a	UTSW	11	29464143	missense	probably benign	0.27
R9610:Ccdc88a	UTSW	11	29477316	missense	possibly damaging	0.76
R9611:Ccdc88a	UTSW	11	29477316	missense	possibly damaging	0.76
R9664:Ccdc88a	UTSW	11	29455484	missense	probably benign	0.08
R9720:Ccdc88a	UTSW	11	29463813	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTCTTTCAAGAAGACAGAACGC -3'
(R):5'- GACGAACACAGGACTCTTTATATAC -3'

Sequencing Primer
(F):5'- ACGCTTGGAAGTTAGCTACC -3'
(R):5'- GTTTTGTTTTCTTTTTCCAAATTCCC -3'

Posted On

2020-10-20