Incidental Mutation 'R8402:Gabrb2'
ID652242
Institutional Source Beutler Lab
Gene Symbol Gabrb2
Ensembl Gene ENSMUSG00000007653
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit beta 2
SynonymsC030002O17Rik, C030021G16Rik, Gabrb-2
MMRRC Submission
Accession Numbers

Genbank: NM_008070

Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R8402 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location42419757-42629028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42487304 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 116 (W116R)
Ref Sequence ENSEMBL: ENSMUSP00000141868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007797] [ENSMUST00000192403]
Predicted Effect probably damaging
Transcript: ENSMUST00000007797
AA Change: W116R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007797
Gene: ENSMUSG00000007653
AA Change: W116R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 36 242 8.7e-52 PFAM
Pfam:Neur_chan_memb 249 469 7.5e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192403
AA Change: W116R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141868
Gene: ENSMUSG00000007653
AA Change: W116R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 36 242 1.1e-54 PFAM
Pfam:Neur_chan_memb 249 507 6.6e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 2 subunit. It is mapped to chromosome 5q34 in a cluster comprised of genes encoding alpha 1 and gamma 2 subunits of the GABA A receptor. Alternative splicing of this gene generates 2 transcript variants, differing by a 114 bp insertion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show hyperactivity and abnormal GABA-mediated receptor currents. Homozygotes for a derivative of this allele show a sexually dimorphic cochlear phenotype associated with OHC dysfunction. Homozygotes for a knock-in allele show altered behavioral response to etomidate. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,323,044 D157V possibly damaging Het
Adamts12 A T 15: 11,263,290 K579N probably damaging Het
Adcy7 T C 8: 88,308,735 V89A probably benign Het
Anapc1 G A 2: 128,630,228 S1458L probably benign Het
AW551984 T C 9: 39,597,653 Y325C probably damaging Het
Btnl4 T C 17: 34,469,493 Y437C probably damaging Het
Ccdc88a T A 11: 29,463,879 S806T probably damaging Het
Ddit4l A G 3: 137,626,127 T85A probably damaging Het
Dmxl1 G A 18: 49,878,326 W1183* probably null Het
Dmxl1 G C 18: 49,878,327 D1184H probably benign Het
Dmxl1 G T 18: 49,878,342 V1189L probably benign Het
Evpl T C 11: 116,225,371 D820G probably benign Het
Fam76b T C 9: 13,839,676 S289P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Galnt7 G A 8: 57,542,919 A355V probably damaging Het
Klk1b5 T G 7: 44,218,538 F45V probably benign Het
Nav2 T C 7: 49,453,437 V661A probably benign Het
Nfkbiz T C 16: 55,816,387 N517S probably damaging Het
Olfr1330 A G 4: 118,893,519 I145M probably benign Het
Olfr975 T A 9: 39,950,417 Y118F probably benign Het
P2rx1 T C 11: 73,013,889 F368L probably damaging Het
Palld A T 8: 61,711,406 V417E probably damaging Het
Robo1 C A 16: 73,024,497 A1375E probably benign Het
Serpind1 A G 16: 17,337,085 N259D probably benign Het
Sh3bp4 C A 1: 89,145,315 N628K probably benign Het
Tada3 A T 6: 113,374,813 L177Q probably damaging Het
Tcam1 T A 11: 106,286,905 L508Q probably damaging Het
Thbs1 T C 2: 118,115,878 S360P possibly damaging Het
Vwa3b A G 1: 37,165,798 E121G probably damaging Het
Zfp607b T A 7: 27,702,702 H194Q probably damaging Het
Zfp729b G A 13: 67,592,577 P523L probably damaging Het
Other mutations in Gabrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02275:Gabrb2 APN 11 42591894 missense probably benign 0.00
IGL02666:Gabrb2 APN 11 42529495 critical splice donor site probably null
IGL02983:Gabrb2 APN 11 42421400 missense probably benign 0.00
IGL03357:Gabrb2 APN 11 42591944 missense probably damaging 1.00
H2330:Gabrb2 UTSW 11 42421431 splice site probably benign
R0049:Gabrb2 UTSW 11 42593847 missense probably damaging 1.00
R0049:Gabrb2 UTSW 11 42593847 missense probably damaging 1.00
R0100:Gabrb2 UTSW 11 42487314 missense probably damaging 1.00
R1423:Gabrb2 UTSW 11 42529471 missense probably damaging 1.00
R1526:Gabrb2 UTSW 11 42591888 missense possibly damaging 0.83
R1856:Gabrb2 UTSW 11 42626713 missense probably benign 0.01
R1898:Gabrb2 UTSW 11 42593832 missense possibly damaging 0.51
R2184:Gabrb2 UTSW 11 42421428 critical splice donor site probably null
R2371:Gabrb2 UTSW 11 42591864 missense probably damaging 1.00
R2915:Gabrb2 UTSW 11 42591907 missense probably benign
R2993:Gabrb2 UTSW 11 42597649 missense probably damaging 0.99
R3951:Gabrb2 UTSW 11 42626881 missense probably damaging 1.00
R4167:Gabrb2 UTSW 11 42421328 unclassified probably benign
R4168:Gabrb2 UTSW 11 42421328 unclassified probably benign
R4497:Gabrb2 UTSW 11 42597694 missense probably benign 0.05
R4572:Gabrb2 UTSW 11 42593917 missense possibly damaging 0.46
R4784:Gabrb2 UTSW 11 42597642 missense probably damaging 1.00
R4792:Gabrb2 UTSW 11 42529503 splice site probably benign
R5345:Gabrb2 UTSW 11 42626809 missense possibly damaging 0.54
R5346:Gabrb2 UTSW 11 42421389 missense probably benign
R5575:Gabrb2 UTSW 11 42529538 intron probably benign
R5701:Gabrb2 UTSW 11 42487374 missense probably damaging 1.00
R5801:Gabrb2 UTSW 11 42421389 missense probably benign 0.00
R5965:Gabrb2 UTSW 11 42626869 missense probably damaging 1.00
R6738:Gabrb2 UTSW 11 42593931 missense possibly damaging 0.95
R6930:Gabrb2 UTSW 11 42597613 missense probably damaging 1.00
R7011:Gabrb2 UTSW 11 42626661 missense possibly damaging 0.76
R7045:Gabrb2 UTSW 11 42593931 missense probably damaging 1.00
R7615:Gabrb2 UTSW 11 42626742 missense probably benign 0.06
R7653:Gabrb2 UTSW 11 42487212 missense probably damaging 1.00
R7866:Gabrb2 UTSW 11 42487223 nonsense probably null
R8094:Gabrb2 UTSW 11 42597543 missense probably damaging 0.98
RF008:Gabrb2 UTSW 11 42626878 missense probably damaging 1.00
X0020:Gabrb2 UTSW 11 42422646 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GAATGCATTTCAGGAGTCTGTG -3'
(R):5'- AGCTCTCAGATATTTCCCTGATAG -3'

Sequencing Primer
(F):5'- CATTTCAGGAGTCTGTGATGATAC -3'
(R):5'- TAGCACGATATAGCCACTGAC -3'
Posted On2020-10-20