Incidental Mutation 'R8402:P2rx1'
ID 652243
Institutional Source Beutler Lab
Gene Symbol P2rx1
Ensembl Gene ENSMUSG00000020787
Gene Name purinergic receptor P2X, ligand-gated ion channel, 1
Synonyms P2X1 receptor, P2x, Pdcd3, RP-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R8402 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 72999103-73015200 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 73013889 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 368 (F368L)
Ref Sequence ENSEMBL: ENSMUSP00000021141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021141] [ENSMUST00000092938]
AlphaFold P51576
Predicted Effect probably damaging
Transcript: ENSMUST00000021141
AA Change: F368L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021141
Gene: ENSMUSG00000020787
AA Change: F368L

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 376 1.2e-157 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092938
AA Change: F341L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090614
Gene: ENSMUSG00000020787
AA Change: F341L

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 182 1.1e-71 PFAM
Pfam:P2X_receptor 171 355 2.1e-76 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the P2X family of G-protein-coupled receptors. These proteins can form homo-and heterotimers and function as ATP-gated ion channels and mediate rapid and selective permeability to cations. This protein is primarily localized to smooth muscle where binds ATP and mediates synaptic transmission between neurons and from neurons to smooth muscle and may being responsible for sympathetic vasoconstriction in small arteries, arterioles and vas deferens. Mouse studies suggest that this receptor is essential for normal male reproductive function. This protein may also be involved in promoting apoptosis. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit low male fertility due to impaired vas deferens contraction and reduced numbers of ejaculated sperm. Mutants also show mild hypertension and reduced susceptibility to experimental thromboembolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,323,044 D157V possibly damaging Het
Adamts12 A T 15: 11,263,290 K579N probably damaging Het
Adcy7 T C 8: 88,308,735 V89A probably benign Het
Anapc1 G A 2: 128,630,228 S1458L probably benign Het
AW551984 T C 9: 39,597,653 Y325C probably damaging Het
Btnl4 T C 17: 34,469,493 Y437C probably damaging Het
Ccdc88a T A 11: 29,463,879 S806T probably damaging Het
Ddit4l A G 3: 137,626,127 T85A probably damaging Het
Dmxl1 G A 18: 49,878,326 W1183* probably null Het
Dmxl1 G C 18: 49,878,327 D1184H probably benign Het
Dmxl1 G T 18: 49,878,342 V1189L probably benign Het
Evpl T C 11: 116,225,371 D820G probably benign Het
Fam76b T C 9: 13,839,676 S289P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gabrb2 T C 11: 42,487,304 W116R probably damaging Het
Galnt7 G A 8: 57,542,919 A355V probably damaging Het
Klk1b5 T G 7: 44,218,538 F45V probably benign Het
Nav2 T C 7: 49,453,437 V661A probably benign Het
Nfkbiz T C 16: 55,816,387 N517S probably damaging Het
Olfr1330 A G 4: 118,893,519 I145M probably benign Het
Olfr975 T A 9: 39,950,417 Y118F probably benign Het
Palld A T 8: 61,711,406 V417E probably damaging Het
Robo1 C A 16: 73,024,497 A1375E probably benign Het
Rps24 G T 14: 24,490,761 probably benign Het
Serpind1 A G 16: 17,337,085 N259D probably benign Het
Sh3bp4 C A 1: 89,145,315 N628K probably benign Het
Tada3 A T 6: 113,374,813 L177Q probably damaging Het
Tcam1 T A 11: 106,286,905 L508Q probably damaging Het
Thbs1 T C 2: 118,115,878 S360P possibly damaging Het
Tmem33 T C 5: 67,267,375 probably benign Het
Vmn2r3 A G 3: 64,271,196 probably benign Het
Vwa3b A G 1: 37,165,798 E121G probably damaging Het
Zfp607b T A 7: 27,702,702 H194Q probably damaging Het
Zfp729b G A 13: 67,592,577 P523L probably damaging Het
Other mutations in P2rx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:P2rx1 APN 11 73013000 critical splice donor site probably null
IGL01109:P2rx1 APN 11 73008215 missense probably damaging 0.99
IGL02466:P2rx1 APN 11 73009584 critical splice acceptor site probably null
IGL02524:P2rx1 APN 11 73009648 missense probably damaging 1.00
IGL02536:P2rx1 APN 11 73012474 missense probably damaging 1.00
PIT4382001:P2rx1 UTSW 11 73009200 missense probably benign 0.09
R0479:P2rx1 UTSW 11 73012961 missense probably damaging 1.00
R1238:P2rx1 UTSW 11 73012958 missense probably damaging 1.00
R2156:P2rx1 UTSW 11 73014113 missense probably benign 0.15
R4016:P2rx1 UTSW 11 73009973 missense probably damaging 1.00
R5345:P2rx1 UTSW 11 73009230 missense probably damaging 1.00
R5440:P2rx1 UTSW 11 73008503 missense probably benign
R6172:P2rx1 UTSW 11 73010030 missense probably damaging 0.99
R6285:P2rx1 UTSW 11 73008148 missense probably benign 0.22
R6348:P2rx1 UTSW 11 72999322 missense probably benign
R7793:P2rx1 UTSW 11 73009253 nonsense probably null
R8520:P2rx1 UTSW 11 73008953 missense probably benign 0.10
R8723:P2rx1 UTSW 11 73008930 missense probably benign 0.05
R8857:P2rx1 UTSW 11 73012371 intron probably benign
R8903:P2rx1 UTSW 11 73009995 missense probably benign 0.03
R8965:P2rx1 UTSW 11 73009225 missense probably benign 0.00
R9007:P2rx1 UTSW 11 73009233 missense probably damaging 0.96
Z1177:P2rx1 UTSW 11 73013899 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGCCAGGACCACAGTCAG -3'
(R):5'- AGGAGGTCCTCATGTTCTCCTG -3'

Sequencing Primer
(F):5'- TCTGTATCTGCCCCAGAT -3'
(R):5'- CACGTTCACCCTGTGTATGCAATG -3'
Posted On 2020-10-20