Incidental Mutation 'R8402:Tcam1'
ID 652244
Institutional Source Beutler Lab
Gene Symbol Tcam1
Ensembl Gene ENSMUSG00000020712
Gene Name testicular cell adhesion molecule 1
Synonyms 4930570F09Rik
MMRRC Submission 067878-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8402 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 106167498-106179571 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 106177731 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 508 (L508Q)
Ref Sequence ENSEMBL: ENSMUSP00000044757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044462] [ENSMUST00000142472]
AlphaFold Q99NB3
Predicted Effect probably damaging
Transcript: ENSMUST00000044462
AA Change: L508Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044757
Gene: ENSMUSG00000020712
AA Change: L508Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 112 5.4e-30 PFAM
IG_like 117 214 1.66e2 SMART
IG_like 316 397 5.04e1 SMART
IG 408 478 2.79e0 SMART
transmembrane domain 488 510 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142472
SMART Domains Protein: ENSMUSP00000115544
Gene: ENSMUSG00000020712

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 112 3.2e-30 PFAM
Pfam:Ig_2 109 214 1.7e-2 PFAM
Pfam:Ig_2 311 396 5.1e-3 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (36/36)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A T 15: 11,263,376 (GRCm39) K579N probably damaging Het
Adcy7 T C 8: 89,035,363 (GRCm39) V89A probably benign Het
Anapc1 G A 2: 128,472,148 (GRCm39) S1458L probably benign Het
AW551984 T C 9: 39,508,949 (GRCm39) Y325C probably damaging Het
Btnl4 T C 17: 34,688,467 (GRCm39) Y437C probably damaging Het
Ccdc88a T A 11: 29,413,879 (GRCm39) S806T probably damaging Het
Clec2m T A 6: 129,300,007 (GRCm39) D157V possibly damaging Het
Ddit4l A G 3: 137,331,888 (GRCm39) T85A probably damaging Het
Dmxl1 G A 18: 50,011,393 (GRCm39) W1183* probably null Het
Dmxl1 G T 18: 50,011,409 (GRCm39) V1189L probably benign Het
Dmxl1 G C 18: 50,011,394 (GRCm39) D1184H probably benign Het
Evpl T C 11: 116,116,197 (GRCm39) D820G probably benign Het
Fam76b T C 9: 13,750,972 (GRCm39) S289P probably damaging Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Gabrb2 T C 11: 42,378,131 (GRCm39) W116R probably damaging Het
Galnt7 G A 8: 57,995,953 (GRCm39) A355V probably damaging Het
Klk1b5 T G 7: 43,867,962 (GRCm39) F45V probably benign Het
Nav2 T C 7: 49,103,185 (GRCm39) V661A probably benign Het
Nfkbiz T C 16: 55,636,750 (GRCm39) N517S probably damaging Het
Or10ak16 A G 4: 118,750,716 (GRCm39) I145M probably benign Het
Or10d5 T A 9: 39,861,713 (GRCm39) Y118F probably benign Het
P2rx1 T C 11: 72,904,715 (GRCm39) F368L probably damaging Het
Palld A T 8: 62,164,440 (GRCm39) V417E probably damaging Het
Robo1 C A 16: 72,821,385 (GRCm39) A1375E probably benign Het
Rps24 G T 14: 24,540,829 (GRCm39) probably benign Het
Serpind1 A G 16: 17,154,949 (GRCm39) N259D probably benign Het
Sh3bp4 C A 1: 89,073,037 (GRCm39) N628K probably benign Het
Tada3 A T 6: 113,351,774 (GRCm39) L177Q probably damaging Het
Thbs1 T C 2: 117,946,359 (GRCm39) S360P possibly damaging Het
Tmem33 T C 5: 67,424,718 (GRCm39) probably benign Het
Vmn2r3 A G 3: 64,178,617 (GRCm39) probably benign Het
Vwa3b A G 1: 37,204,879 (GRCm39) E121G probably damaging Het
Zfp607b T A 7: 27,402,127 (GRCm39) H194Q probably damaging Het
Zfp729b G A 13: 67,740,696 (GRCm39) P523L probably damaging Het
Other mutations in Tcam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03189:Tcam1 APN 11 106,176,212 (GRCm39) missense probably benign
IGL03396:Tcam1 APN 11 106,176,212 (GRCm39) missense probably benign
IGL03397:Tcam1 APN 11 106,176,212 (GRCm39) missense probably benign
R0241:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R0241:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R0306:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R0313:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R0378:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R0380:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R0381:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R0382:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R0393:Tcam1 UTSW 11 106,175,040 (GRCm39) missense probably benign 0.19
R0401:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R0448:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R0537:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R0602:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R0669:Tcam1 UTSW 11 106,176,252 (GRCm39) missense possibly damaging 0.94
R0706:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R2307:Tcam1 UTSW 11 106,174,940 (GRCm39) missense probably damaging 1.00
R4957:Tcam1 UTSW 11 106,173,705 (GRCm39) missense probably damaging 1.00
R5050:Tcam1 UTSW 11 106,176,278 (GRCm39) missense possibly damaging 0.93
R5269:Tcam1 UTSW 11 106,176,353 (GRCm39) missense probably benign 0.24
R5437:Tcam1 UTSW 11 106,176,249 (GRCm39) missense probably damaging 1.00
R6235:Tcam1 UTSW 11 106,174,880 (GRCm39) nonsense probably null
R6248:Tcam1 UTSW 11 106,173,652 (GRCm39) missense probably benign 0.17
R6302:Tcam1 UTSW 11 106,177,276 (GRCm39) missense probably damaging 1.00
R7399:Tcam1 UTSW 11 106,174,911 (GRCm39) missense probably damaging 1.00
R8236:Tcam1 UTSW 11 106,177,243 (GRCm39) missense probably benign 0.01
R8751:Tcam1 UTSW 11 106,176,443 (GRCm39) missense possibly damaging 0.83
R8801:Tcam1 UTSW 11 106,173,618 (GRCm39) missense probably benign
R9228:Tcam1 UTSW 11 106,177,292 (GRCm39) missense probably damaging 1.00
R9233:Tcam1 UTSW 11 106,175,018 (GRCm39) missense probably benign 0.00
R9621:Tcam1 UTSW 11 106,176,259 (GRCm39) missense probably damaging 1.00
Z1177:Tcam1 UTSW 11 106,173,676 (GRCm39) missense probably benign 0.20
Z1177:Tcam1 UTSW 11 106,173,673 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATTCTCCCTCAAACGTGGAGG -3'
(R):5'- TCCCTGTAAATGCTGGTAGCTG -3'

Sequencing Primer
(F):5'- AGAGAGATGCTCCTGGGCTG -3'
(R):5'- ATGCTGGTAGCTGAAGTCACACTC -3'
Posted On 2020-10-20