Mutagenetix > Incidental Mutations

Incidental Mutation 'R8402:Evpl'

652245

Institutional Source

Beutler Lab

Gene Symbol

Evpl

Ensembl Gene

ENSMUSG00000034282

Gene Name

envoplakin

Synonyms

210kDa protein

MMRRC Submission

Accession Numbers

Genbank: NM_025276; MGI: 107507

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8402 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

116220559-116238077 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 116225371 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 820 (D820G)

Ref Sequence

ENSEMBL: ENSMUSP00000037850 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037007]

AlphaFold

Q9D952

Predicted Effect

probably benign
Transcript: ENSMUST00000037007
AA Change: D820G

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000037850
Gene: ENSMUSG00000034282
AA Change: D820G

Domain	Start	End	E-Value	Type
low complexity region	3	30	N/A	INTRINSIC
Blast:SPEC	44	140	1e-16	BLAST
Blast:SPEC	140	226	4e-46	BLAST
SPEC	229	330	2.21e-6	SMART
Blast:SPEC	336	500	7e-68	BLAST
low complexity region	508	525	N/A	INTRINSIC
Blast:SPEC	527	632	4e-41	BLAST
Blast:SPEC	635	746	5e-48	BLAST
Blast:SPEC	753	867	7e-49	BLAST
low complexity region	868	881	N/A	INTRINSIC
low complexity region	933	950	N/A	INTRINSIC
internal_repeat_2	1011	1030	6.54e-6	PROSPERO
internal_repeat_3	1012	1032	1.94e-5	PROSPERO
coiled coil region	1035	1077	N/A	INTRINSIC
low complexity region	1131	1144	N/A	INTRINSIC
low complexity region	1149	1164	N/A	INTRINSIC
PLEC	1186	1227	1.48e2	SMART
low complexity region	1228	1242	N/A	INTRINSIC
coiled coil region	1262	1366	N/A	INTRINSIC
low complexity region	1398	1414	N/A	INTRINSIC
internal_repeat_2	1457	1476	6.54e-6	PROSPERO
internal_repeat_3	1516	1536	1.94e-5	PROSPERO
low complexity region	1595	1617	N/A	INTRINSIC
PLEC	1679	1714	9.19e-4	SMART
PLEC	1729	1764	4.53e1	SMART
low complexity region	1788	1800	N/A	INTRINSIC
PLEC	1819	1856	1.41e-4	SMART
PLEC	1857	1894	5.4e-10	SMART
PLEC	1895	1932	2.7e-10	SMART
PLEC	1933	1970	1.21e-3	SMART
PLEC	1971	2008	1.16e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plakin family of proteins that forms a component of desmosomes and the epidermal cornified envelope. This gene is located in the tylosis oesophageal cancer locus on chromosome 17q25, and its deletion is associated with both familial and sporadic forms of oesophageal squamous cell carcinoma. Patients suffering from the autoimmune mucocutaneous disorder, paraneoplastic pemphigus, develop antibodies against the encoded protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted deletion of this gene are viable and fertile. Surprisingly, cornified envelope assembly is not inhibited and adult homozygotes show no obvious pathological phenotype in skin or other epithelia, despite a slight delay in barrier acquisition during embryonic development. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, other(3)

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	T	A	6: 129,323,044	D157V	possibly damaging	Het
Adamts12	A	T	15: 11,263,290	K579N	probably damaging	Het
Adcy7	T	C	8: 88,308,735	V89A	probably benign	Het
Anapc1	G	A	2: 128,630,228	S1458L	probably benign	Het
AW551984	T	C	9: 39,597,653	Y325C	probably damaging	Het
Btnl4	T	C	17: 34,469,493	Y437C	probably damaging	Het
Ccdc88a	T	A	11: 29,463,879	S806T	probably damaging	Het
Ddit4l	A	G	3: 137,626,127	T85A	probably damaging	Het
Dmxl1	G	A	18: 49,878,326	W1183*	probably null	Het
Dmxl1	G	C	18: 49,878,327	D1184H	probably benign	Het
Dmxl1	G	T	18: 49,878,342	V1189L	probably benign	Het
Fam76b	T	C	9: 13,839,676	S289P	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Gabrb2	T	C	11: 42,487,304	W116R	probably damaging	Het
Galnt7	G	A	8: 57,542,919	A355V	probably damaging	Het
Klk1b5	T	G	7: 44,218,538	F45V	probably benign	Het
Nav2	T	C	7: 49,453,437	V661A	probably benign	Het
Nfkbiz	T	C	16: 55,816,387	N517S	probably damaging	Het
Olfr1330	A	G	4: 118,893,519	I145M	probably benign	Het
Olfr975	T	A	9: 39,950,417	Y118F	probably benign	Het
P2rx1	T	C	11: 73,013,889	F368L	probably damaging	Het
Palld	A	T	8: 61,711,406	V417E	probably damaging	Het
Robo1	C	A	16: 73,024,497	A1375E	probably benign	Het
Rps24	G	T	14: 24,490,761		probably benign	Het
Serpind1	A	G	16: 17,337,085	N259D	probably benign	Het
Sh3bp4	C	A	1: 89,145,315	N628K	probably benign	Het
Tada3	A	T	6: 113,374,813	L177Q	probably damaging	Het
Tcam1	T	A	11: 106,286,905	L508Q	probably damaging	Het
Thbs1	T	C	2: 118,115,878	S360P	possibly damaging	Het
Tmem33	T	C	5: 67,267,375		probably benign	Het
Vmn2r3	A	G	3: 64,271,196		probably benign	Het
Vwa3b	A	G	1: 37,165,798	E121G	probably damaging	Het
Zfp607b	T	A	7: 27,702,702	H194Q	probably damaging	Het
Zfp729b	G	A	13: 67,592,577	P523L	probably damaging	Het

Other mutations in Evpl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Evpl	APN	11	116234505	missense	probably benign	0.01
IGL00896:Evpl	APN	11	116222584	nonsense	probably null
IGL00941:Evpl	APN	11	116227901	missense	probably benign	0.06
IGL01443:Evpl	APN	11	116222454	missense	probably damaging	1.00
IGL01523:Evpl	APN	11	116233444	missense	probably damaging	1.00
IGL01957:Evpl	APN	11	116223222	missense	probably damaging	1.00
IGL02124:Evpl	APN	11	116227015	missense	probably benign	0.01
IGL02334:Evpl	APN	11	116231024	nonsense	probably null
IGL02457:Evpl	APN	11	116230113	missense	possibly damaging	0.87
IGL02502:Evpl	APN	11	116222718	missense	probably damaging	1.00
IGL02536:Evpl	APN	11	116221209	missense	probably damaging	1.00
IGL02948:Evpl	APN	11	116221822	missense	probably damaging	1.00
IGL03183:Evpl	APN	11	116221612	missense	probably damaging	0.98
IGL03405:Evpl	APN	11	116227927	missense	possibly damaging	0.89
A4554:Evpl	UTSW	11	116220834	missense	probably damaging	1.00
BB005:Evpl	UTSW	11	116222533	missense	possibly damaging	0.63
BB015:Evpl	UTSW	11	116222533	missense	possibly damaging	0.63
PIT4449001:Evpl	UTSW	11	116233399	missense	possibly damaging	0.87
R0082:Evpl	UTSW	11	116235003	missense	probably damaging	1.00
R0108:Evpl	UTSW	11	116220876	missense	probably damaging	1.00
R0514:Evpl	UTSW	11	116223291	missense	probably damaging	0.99
R0581:Evpl	UTSW	11	116229490	missense	probably benign	0.02
R0727:Evpl	UTSW	11	116232485	missense	probably damaging	1.00
R0791:Evpl	UTSW	11	116227723	missense	probably damaging	1.00
R0792:Evpl	UTSW	11	116227723	missense	probably damaging	1.00
R1079:Evpl	UTSW	11	116230068	missense	possibly damaging	0.48
R1514:Evpl	UTSW	11	116223835	missense	probably benign
R1699:Evpl	UTSW	11	116227588	missense	probably damaging	1.00
R1717:Evpl	UTSW	11	116225492	missense	probably benign	0.06
R1775:Evpl	UTSW	11	116223660	missense	possibly damaging	0.66
R1886:Evpl	UTSW	11	116227576	missense	probably damaging	0.97
R1903:Evpl	UTSW	11	116227028	missense	probably damaging	1.00
R2081:Evpl	UTSW	11	116234266	missense	probably damaging	1.00
R2137:Evpl	UTSW	11	116221839	missense	probably damaging	0.99
R2571:Evpl	UTSW	11	116237969	missense	unknown
R3081:Evpl	UTSW	11	116220852	missense	probably damaging	1.00
R4097:Evpl	UTSW	11	116223177	missense	possibly damaging	0.89
R4541:Evpl	UTSW	11	116232644	missense	probably benign	0.01
R4562:Evpl	UTSW	11	116233399	missense	possibly damaging	0.87
R4703:Evpl	UTSW	11	116222505	missense	probably damaging	0.98
R4947:Evpl	UTSW	11	116223375	missense	possibly damaging	0.88
R5243:Evpl	UTSW	11	116222969	missense	probably damaging	1.00
R5325:Evpl	UTSW	11	116221365	missense	probably damaging	1.00
R5416:Evpl	UTSW	11	116234259	missense	probably benign	0.13
R5580:Evpl	UTSW	11	116234232	missense	probably benign	0.14
R5873:Evpl	UTSW	11	116234432	missense	probably damaging	1.00
R6298:Evpl	UTSW	11	116230922	missense	probably damaging	1.00
R6438:Evpl	UTSW	11	116230101	missense	probably benign	0.00
R6742:Evpl	UTSW	11	116222814	missense	possibly damaging	0.80
R6753:Evpl	UTSW	11	116237906	missense	possibly damaging	0.95
R6764:Evpl	UTSW	11	116222944	missense	probably damaging	0.99
R6846:Evpl	UTSW	11	116223807	missense	probably damaging	1.00
R7278:Evpl	UTSW	11	116223113	missense	probably damaging	1.00
R7288:Evpl	UTSW	11	116223949	missense	probably benign
R7395:Evpl	UTSW	11	116227079	missense	possibly damaging	0.94
R7441:Evpl	UTSW	11	116222956	nonsense	probably null
R7505:Evpl	UTSW	11	116226987	critical splice donor site	probably null
R7674:Evpl	UTSW	11	116222568	missense	probably benign	0.40
R7772:Evpl	UTSW	11	116221435	missense	probably benign	0.00
R7780:Evpl	UTSW	11	116234174	missense	not run
R7861:Evpl	UTSW	11	116228069	missense	probably damaging	1.00
R7928:Evpl	UTSW	11	116222533	missense	possibly damaging	0.63
R8008:Evpl	UTSW	11	116230472	missense	probably null	0.21
R8040:Evpl	UTSW	11	116222932	missense	probably damaging	0.99
R8052:Evpl	UTSW	11	116223163	missense	probably benign	0.00
R8513:Evpl	UTSW	11	116229744	critical splice donor site	probably null
R8695:Evpl	UTSW	11	116223663	missense	probably benign	0.02
R8725:Evpl	UTSW	11	116222193	missense	probably benign	0.25
R8749:Evpl	UTSW	11	116229406	missense	probably benign	0.01
R8807:Evpl	UTSW	11	116221027	missense	probably damaging	1.00
R8883:Evpl	UTSW	11	116230417	missense	probably damaging	0.99
R8947:Evpl	UTSW	11	116221338	missense	probably damaging	1.00
R9123:Evpl	UTSW	11	116224182	missense	possibly damaging	0.62
R9314:Evpl	UTSW	11	116227677	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- TTCTCCTGGGAACAAAGTGGG -3'
(R):5'- ATACAAGAAATCCTGGGGCGC -3'

Sequencing Primer
(F):5'- ACAGCAGAGTCAGCTCCG -3'
(R):5'- CGAGCAGGACCAGGCCAC -3'

Posted On

2020-10-20