Incidental Mutation 'R8402:Zfp729b'
ID 652246
Institutional Source Beutler Lab
Gene Symbol Zfp729b
Ensembl Gene ENSMUSG00000058093
Gene Name zinc finger protein 729b
Synonyms AA987161
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R8402 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 67589439-67609707 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 67592577 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 523 (P523L)
Ref Sequence ENSEMBL: ENSMUSP00000012873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012873] [ENSMUST00000138725] [ENSMUST00000224814] [ENSMUST00000225627]
AlphaFold Q80VN4
Predicted Effect probably damaging
Transcript: ENSMUST00000012873
AA Change: P523L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000012873
Gene: ENSMUSG00000058093
AA Change: P523L

DomainStartEndE-ValueType
KRAB 5 65 1.63e-28 SMART
ZnF_C2H2 132 154 3.58e-2 SMART
PHD 133 194 1e1 SMART
ZnF_C2H2 160 182 3.21e-4 SMART
ZnF_C2H2 188 210 6.78e-3 SMART
ZnF_C2H2 216 238 3.16e-3 SMART
PHD 217 278 7.77e0 SMART
ZnF_C2H2 244 266 6.67e-2 SMART
ZnF_C2H2 272 294 1.12e-3 SMART
ZnF_C2H2 300 322 1.79e-2 SMART
PHD 301 362 1.65e1 SMART
ZnF_C2H2 328 350 2.57e-3 SMART
ZnF_C2H2 356 378 2.43e-4 SMART
ZnF_C2H2 412 434 1.67e-2 SMART
ZnF_C2H2 440 462 1.28e-3 SMART
PHD 441 502 4.46e0 SMART
ZnF_C2H2 468 490 1.58e-3 SMART
ZnF_C2H2 496 518 2.95e-3 SMART
ZnF_C2H2 524 546 4.47e-3 SMART
PHD 525 586 5.77e0 SMART
ZnF_C2H2 552 574 5.42e-2 SMART
ZnF_C2H2 580 602 1.03e-2 SMART
ZnF_C2H2 608 630 5.5e-3 SMART
PHD 609 670 1.52e1 SMART
ZnF_C2H2 636 658 6.99e-5 SMART
ZnF_C2H2 664 686 3.34e-2 SMART
ZnF_C2H2 720 742 3.63e-3 SMART
PHD 721 782 2.67e0 SMART
ZnF_C2H2 748 770 5.42e-2 SMART
ZnF_C2H2 776 798 5.14e-3 SMART
ZnF_C2H2 804 826 4.17e-3 SMART
ZnF_C2H2 832 854 1.47e-3 SMART
PHD 833 894 4.93e0 SMART
ZnF_C2H2 860 882 3.83e-2 SMART
ZnF_C2H2 888 910 4.4e-2 SMART
ZnF_C2H2 916 938 7.78e-3 SMART
ZnF_C2H2 944 966 4.17e-3 SMART
ZnF_C2H2 972 994 1.38e-3 SMART
ZnF_C2H2 1000 1022 1.69e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138725
SMART Domains Protein: ENSMUSP00000115783
Gene: ENSMUSG00000058093

DomainStartEndE-ValueType
KRAB 15 75 1.63e-28 SMART
ZnF_C2H2 142 164 3.58e-2 SMART
ZnF_C2H2 170 192 3.21e-4 SMART
ZnF_C2H2 198 220 6.78e-3 SMART
ZnF_C2H2 226 248 3.16e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000224814
AA Change: P533L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000225627
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,323,044 D157V possibly damaging Het
Adamts12 A T 15: 11,263,290 K579N probably damaging Het
Adcy7 T C 8: 88,308,735 V89A probably benign Het
Anapc1 G A 2: 128,630,228 S1458L probably benign Het
AW551984 T C 9: 39,597,653 Y325C probably damaging Het
Btnl4 T C 17: 34,469,493 Y437C probably damaging Het
Ccdc88a T A 11: 29,463,879 S806T probably damaging Het
Ddit4l A G 3: 137,626,127 T85A probably damaging Het
Dmxl1 G A 18: 49,878,326 W1183* probably null Het
Dmxl1 G C 18: 49,878,327 D1184H probably benign Het
Dmxl1 G T 18: 49,878,342 V1189L probably benign Het
Evpl T C 11: 116,225,371 D820G probably benign Het
Fam76b T C 9: 13,839,676 S289P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gabrb2 T C 11: 42,487,304 W116R probably damaging Het
Galnt7 G A 8: 57,542,919 A355V probably damaging Het
Klk1b5 T G 7: 44,218,538 F45V probably benign Het
Nav2 T C 7: 49,453,437 V661A probably benign Het
Nfkbiz T C 16: 55,816,387 N517S probably damaging Het
Olfr1330 A G 4: 118,893,519 I145M probably benign Het
Olfr975 T A 9: 39,950,417 Y118F probably benign Het
P2rx1 T C 11: 73,013,889 F368L probably damaging Het
Palld A T 8: 61,711,406 V417E probably damaging Het
Robo1 C A 16: 73,024,497 A1375E probably benign Het
Rps24 G T 14: 24,490,761 probably benign Het
Serpind1 A G 16: 17,337,085 N259D probably benign Het
Sh3bp4 C A 1: 89,145,315 N628K probably benign Het
Tada3 A T 6: 113,374,813 L177Q probably damaging Het
Tcam1 T A 11: 106,286,905 L508Q probably damaging Het
Thbs1 T C 2: 118,115,878 S360P possibly damaging Het
Tmem33 T C 5: 67,267,375 probably benign Het
Vmn2r3 A G 3: 64,271,196 probably benign Het
Vwa3b A G 1: 37,165,798 E121G probably damaging Het
Zfp607b T A 7: 27,702,702 H194Q probably damaging Het
Other mutations in Zfp729b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02083:Zfp729b APN 13 67595230 missense probably benign 0.09
IGL02852:Zfp729b APN 13 67592823 missense probably damaging 0.99
PIT4449001:Zfp729b UTSW 13 67591423 missense probably benign 0.01
R0238:Zfp729b UTSW 13 67591903 missense probably damaging 0.98
R0238:Zfp729b UTSW 13 67591903 missense probably damaging 0.98
R0450:Zfp729b UTSW 13 67591134 missense probably benign
R0510:Zfp729b UTSW 13 67591134 missense probably benign
R1122:Zfp729b UTSW 13 67595284 missense possibly damaging 0.75
R1400:Zfp729b UTSW 13 67592794 missense possibly damaging 0.63
R1915:Zfp729b UTSW 13 67593220 missense probably damaging 1.00
R1929:Zfp729b UTSW 13 67592233 missense probably damaging 1.00
R2229:Zfp729b UTSW 13 67595265 missense probably damaging 0.99
R2270:Zfp729b UTSW 13 67592233 missense probably damaging 1.00
R2271:Zfp729b UTSW 13 67592233 missense probably damaging 1.00
R2344:Zfp729b UTSW 13 67592233 missense probably damaging 1.00
R2377:Zfp729b UTSW 13 67591701 missense possibly damaging 0.70
R2930:Zfp729b UTSW 13 67591854 missense probably benign
R3053:Zfp729b UTSW 13 67593466 missense probably damaging 1.00
R3404:Zfp729b UTSW 13 67591164 missense probably damaging 0.98
R4118:Zfp729b UTSW 13 67592710 missense possibly damaging 0.91
R4947:Zfp729b UTSW 13 67596672 missense probably damaging 1.00
R5408:Zfp729b UTSW 13 67591444 missense probably benign 0.18
R5511:Zfp729b UTSW 13 67592380 missense probably damaging 1.00
R5542:Zfp729b UTSW 13 67591021 missense probably benign
R5908:Zfp729b UTSW 13 67591255 missense probably benign 0.00
R5977:Zfp729b UTSW 13 67591621 missense probably benign 0.03
R5996:Zfp729b UTSW 13 67593858 missense probably benign 0.18
R7086:Zfp729b UTSW 13 67592937 missense probably damaging 0.99
R7146:Zfp729b UTSW 13 67593376 missense probably damaging 1.00
R7217:Zfp729b UTSW 13 67595248 missense probably damaging 0.96
R7332:Zfp729b UTSW 13 67609636 splice site probably null
R7472:Zfp729b UTSW 13 67593883 missense probably benign 0.00
R7615:Zfp729b UTSW 13 67591498 missense possibly damaging 0.77
R7639:Zfp729b UTSW 13 67591852 missense probably benign 0.02
R7652:Zfp729b UTSW 13 67591252 missense probably benign 0.00
R7738:Zfp729b UTSW 13 67592075 missense probably benign 0.00
R8137:Zfp729b UTSW 13 67592742 missense probably damaging 1.00
R8381:Zfp729b UTSW 13 67591498 missense possibly damaging 0.77
R8941:Zfp729b UTSW 13 67593099 missense possibly damaging 0.95
R9014:Zfp729b UTSW 13 67592155 missense probably damaging 1.00
R9091:Zfp729b UTSW 13 67592361 missense probably damaging 1.00
R9168:Zfp729b UTSW 13 67593823 nonsense probably null
R9270:Zfp729b UTSW 13 67592361 missense probably damaging 1.00
R9390:Zfp729b UTSW 13 67591063 missense probably benign 0.00
R9390:Zfp729b UTSW 13 67593895 missense possibly damaging 0.95
X0023:Zfp729b UTSW 13 67592459 missense possibly damaging 0.95
X0028:Zfp729b UTSW 13 67592194 missense probably damaging 1.00
Z1088:Zfp729b UTSW 13 67593070 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGGAGAACAGAAGGCCTTTC -3'
(R):5'- TCCATCAAGACTTTCCACGC -3'

Sequencing Primer
(F):5'- TAATGGAAGGCCTTGTCACAC -3'
(R):5'- GACTTTCCACGCATAAGAGAATTC -3'
Posted On 2020-10-20