Incidental Mutation 'R8402:Serpind1'
ID 652248
Institutional Source Beutler Lab
Gene Symbol Serpind1
Ensembl Gene ENSMUSG00000022766
Gene Name serine (or cysteine) peptidase inhibitor, clade D, member 1
Synonyms HCII, HC II, Hcf2, heparin cofactor II
MMRRC Submission 067878-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.098) question?
Stock # R8402 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 17331371-17343575 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 17337085 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 259 (N259D)
Ref Sequence ENSEMBL: ENSMUSP00000023450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023450] [ENSMUST00000036161] [ENSMUST00000231884] [ENSMUST00000232232]
AlphaFold P49182
Predicted Effect probably benign
Transcript: ENSMUST00000023450
AA Change: N259D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023450
Gene: ENSMUSG00000022766
AA Change: N259D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
SERPIN 114 475 9.76e-160 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036161
SMART Domains Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231884
AA Change: N259D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000232232
Predicted Effect probably benign
Transcript: ENSMUST00000232404
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the serpin gene superfamily. Serpins play roles in many processes including inflammation, blood clotting, and cancer metastasis. Members of this family have highly conserved secondary structures with a reactive center loop that interacts with the protease active site to inhibit protease activity. This gene encodes a plasma serine protease that functions as a thrombin and chymotrypsin inhibitor. The protein is activated by heparin, dermatan sulfate, and glycosaminoglycans. Allelic variations in this gene are associated with heparin cofactor II deficiency. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,323,044 D157V possibly damaging Het
Adamts12 A T 15: 11,263,290 K579N probably damaging Het
Adcy7 T C 8: 88,308,735 V89A probably benign Het
Anapc1 G A 2: 128,630,228 S1458L probably benign Het
AW551984 T C 9: 39,597,653 Y325C probably damaging Het
Btnl4 T C 17: 34,469,493 Y437C probably damaging Het
Ccdc88a T A 11: 29,463,879 S806T probably damaging Het
Ddit4l A G 3: 137,626,127 T85A probably damaging Het
Dmxl1 G A 18: 49,878,326 W1183* probably null Het
Dmxl1 G C 18: 49,878,327 D1184H probably benign Het
Dmxl1 G T 18: 49,878,342 V1189L probably benign Het
Evpl T C 11: 116,225,371 D820G probably benign Het
Fam76b T C 9: 13,839,676 S289P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gabrb2 T C 11: 42,487,304 W116R probably damaging Het
Galnt7 G A 8: 57,542,919 A355V probably damaging Het
Klk1b5 T G 7: 44,218,538 F45V probably benign Het
Nav2 T C 7: 49,453,437 V661A probably benign Het
Nfkbiz T C 16: 55,816,387 N517S probably damaging Het
Olfr1330 A G 4: 118,893,519 I145M probably benign Het
Olfr975 T A 9: 39,950,417 Y118F probably benign Het
P2rx1 T C 11: 73,013,889 F368L probably damaging Het
Palld A T 8: 61,711,406 V417E probably damaging Het
Robo1 C A 16: 73,024,497 A1375E probably benign Het
Rps24 G T 14: 24,490,761 probably benign Het
Sh3bp4 C A 1: 89,145,315 N628K probably benign Het
Tada3 A T 6: 113,374,813 L177Q probably damaging Het
Tcam1 T A 11: 106,286,905 L508Q probably damaging Het
Thbs1 T C 2: 118,115,878 S360P possibly damaging Het
Tmem33 T C 5: 67,267,375 probably benign Het
Vmn2r3 A G 3: 64,271,196 probably benign Het
Vwa3b A G 1: 37,165,798 E121G probably damaging Het
Zfp607b T A 7: 27,702,702 H194Q probably damaging Het
Zfp729b G A 13: 67,592,577 P523L probably damaging Het
Other mutations in Serpind1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Serpind1 APN 16 17336923 missense probably benign 0.00
R1433:Serpind1 UTSW 16 17342385 missense probably damaging 1.00
R1839:Serpind1 UTSW 16 17342992 missense probably damaging 1.00
R1991:Serpind1 UTSW 16 17342944 missense probably benign 0.00
R2103:Serpind1 UTSW 16 17342944 missense probably benign 0.00
R2937:Serpind1 UTSW 16 17337108 missense probably benign 0.01
R4774:Serpind1 UTSW 16 17336408 missense probably benign
R5233:Serpind1 UTSW 16 17336894 missense probably damaging 1.00
R5493:Serpind1 UTSW 16 17340038 missense probably damaging 1.00
R5713:Serpind1 UTSW 16 17336987 missense probably damaging 1.00
R5720:Serpind1 UTSW 16 17339832 missense probably benign 0.02
R7553:Serpind1 UTSW 16 17336675 missense probably benign 0.00
R8311:Serpind1 UTSW 16 17342866 missense possibly damaging 0.72
R8531:Serpind1 UTSW 16 17342983 missense probably damaging 1.00
R9468:Serpind1 UTSW 16 17336315 missense possibly damaging 0.81
R9539:Serpind1 UTSW 16 17339774 nonsense probably null
R9648:Serpind1 UTSW 16 17336454 missense probably benign 0.18
X0020:Serpind1 UTSW 16 17336720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGAAAGCTGACCCATCGTC -3'
(R):5'- CCTGTCCCTGAATTAACCTAGTGTC -3'

Sequencing Primer
(F):5'- GTACACACTTCGGTCAGTTAATGGC -3'
(R):5'- CCTGTGAGTTTCCTTTGAG -3'
Posted On 2020-10-20