Incidental Mutation 'R8403:Ttl'
ID652258
Institutional Source Beutler Lab
Gene Symbol Ttl
Ensembl Gene ENSMUSG00000027394
Gene Nametubulin tyrosine ligase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8403 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location129065942-129096283 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129081243 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 168 (E168G)
Ref Sequence ENSEMBL: ENSMUSP00000046883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035812]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035812
AA Change: E168G

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046883
Gene: ENSMUSG00000027394
AA Change: E168G

DomainStartEndE-ValueType
Pfam:TTL 54 367 1.2e-72 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000117506
Gene: ENSMUSG00000027394
AA Change: E26G

DomainStartEndE-ValueType
Pfam:TTL 1 199 2.3e-64 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TTL is a cytosolic enzyme involved in the posttranslational modification of alpha-tubulin (see MIM 602529). Alpha-tubulin within assembled microtubules is detyrosinated over time at the C terminus. After microtubule disassembly, TTL restores the tyrosine residues and consequently participates in a cycle of tubulin detyrosination and tyrosination (Erck et al., 2003 [PubMed 14571137]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality, impaired breathing, and fail to form the internal capsule in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora2b T A 11: 62,249,315 C72S probably damaging Het
Atcay T C 10: 81,212,948 Y183C probably damaging Het
Atp1a1 A T 3: 101,586,904 I460N probably damaging Het
Celf4 T C 18: 25,504,270 S223G possibly damaging Het
Ces2c T A 8: 104,848,082 V57D probably damaging Het
Ces2f T C 8: 104,948,176 V70A possibly damaging Het
Cntnap1 C T 11: 101,177,590 P114S probably damaging Het
Cpsf1 A G 15: 76,600,283 F666S probably damaging Het
Cuzd1 T A 7: 131,311,568 D440V probably damaging Het
Dhx57 T C 17: 80,278,289 E107G probably damaging Het
Dopey1 G T 9: 86,500,872 R286L probably damaging Het
Fam135a G A 1: 24,028,827 T987I probably benign Het
Fastkd1 G T 2: 69,687,081 Y818* probably null Het
Fer1l4 A C 2: 156,052,243 F47V possibly damaging Het
Fryl A G 5: 73,118,447 *125R probably null Het
Gm5096 C T 18: 87,757,451 S366F probably damaging Het
Herc6 A G 6: 57,583,206 D77G probably benign Het
Hmox1 T C 8: 75,097,331 L209P probably damaging Het
Kcns3 A T 12: 11,091,653 D348E probably benign Het
Lama1 T A 17: 67,745,923 I417N Het
Lmo7 T C 14: 101,902,364 S1028P probably benign Het
Lrrc37a C G 11: 103,501,585 E1005Q probably benign Het
Mis18bp1 A T 12: 65,154,811 I372K possibly damaging Het
Nr4a3 A G 4: 48,051,348 D34G probably damaging Het
Olfr1218 A T 2: 89,054,604 V274D probably benign Het
Parp12 T C 6: 39,091,345 D496G probably benign Het
Rom1 A G 19: 8,927,880 V282A probably benign Het
Rp1l1 G A 14: 64,028,809 V615I probably benign Het
Rpgrip1 A G 14: 52,152,201 probably null Het
Ryr2 A G 13: 11,684,478 I2959T possibly damaging Het
Sema4a T G 3: 88,452,034 K117Q probably damaging Het
Slc22a29 A G 19: 8,161,640 M486T possibly damaging Het
Sntb2 T A 8: 107,001,534 C371* probably null Het
Spata31d1c A G 13: 65,036,230 T529A probably benign Het
Tchp G T 5: 114,708,766 R38L possibly damaging Het
Tnpo2 T C 8: 85,047,297 V320A probably benign Het
Trim50 A T 5: 135,363,792 D187V probably damaging Het
Tuba1c T A 15: 99,034,104 I5N probably damaging Het
Tyr C T 7: 87,437,967 G446R probably damaging Het
Vps35 C T 8: 85,274,858 V444I probably benign Het
Vstm2b T C 7: 40,902,475 S76P probably damaging Het
Other mutations in Ttl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02742:Ttl APN 2 129066293 missense possibly damaging 0.50
IGL02970:Ttl APN 2 129076070 missense probably damaging 1.00
R0363:Ttl UTSW 2 129076061 missense probably damaging 0.99
R2290:Ttl UTSW 2 129081270 missense possibly damaging 0.69
R3818:Ttl UTSW 2 129092994 missense probably damaging 1.00
R4345:Ttl UTSW 2 129075858 missense probably damaging 1.00
R4471:Ttl UTSW 2 129082057 missense probably benign
R4866:Ttl UTSW 2 129081227 missense probably damaging 1.00
R5269:Ttl UTSW 2 129068911 missense probably damaging 1.00
R5913:Ttl UTSW 2 129076041 missense probably benign
R5941:Ttl UTSW 2 129075984 missense probably benign 0.00
R6287:Ttl UTSW 2 129089121 missense probably damaging 1.00
R6643:Ttl UTSW 2 129081342 missense possibly damaging 0.72
R6821:Ttl UTSW 2 129068915 missense probably damaging 1.00
R6883:Ttl UTSW 2 129082072 missense possibly damaging 0.81
R8273:Ttl UTSW 2 129068933 missense probably benign 0.05
R8354:Ttl UTSW 2 129066184 missense probably damaging 1.00
R8454:Ttl UTSW 2 129066184 missense probably damaging 1.00
R8817:Ttl UTSW 2 129068858 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCGCTCTATGGAGAAGTTAATG -3'
(R):5'- ATCTTGGCCAGCACCATAATC -3'

Sequencing Primer
(F):5'- CTCTATGGAGAAGTTAATGGGATGGC -3'
(R):5'- TTGGCCAGCACCATAATCTAAGTAG -3'
Posted On2020-10-20