Mutagenetix > Incidental Mutation

Incidental Mutation 'R8403:Fryl'

652263

Institutional Source

Beutler Lab

Gene Symbol

Fryl

Ensembl Gene

ENSMUSG00000070733

Gene Name

FRY like transcription coactivator

Synonyms

2510002A14Rik, 2310004H21Rik, 9030227G01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.765) question?

Stock #

R8403 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

73019987-73256619 bp(-) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

A to G at 73118447 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Arginine at position 125 (*125R)

Ref Sequence

ENSEMBL: ENSMUSP00000115208 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094700] [ENSMUST00000101127] [ENSMUST00000152631] [ENSMUST00000153903]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000094700

SMART Domains

Protein: ENSMUSP00000092289
Gene: ENSMUSG00000070733

Domain	Start	End	E-Value	Type
Pfam:MOR2-PAG1_N	117	649	5.7e-176	PFAM
low complexity region	873	884	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	896	1141	1.3e-5	PFAM
Pfam:MOR2-PAG1_mid	1145	1331	2e-19	PFAM
Pfam:MOR2-PAG1_mid	1351	1450	1.2e-5	PFAM
low complexity region	1476	1487	N/A	INTRINSIC
low complexity region	1530	1548	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	1590	1660	1.1e-5	PFAM
Pfam:MOR2-PAG1_mid	1725	1866	3.2e-15	PFAM
low complexity region	1973	1984	N/A	INTRINSIC
Pfam:MOR2-PAG1_C	2002	2255	9.9e-78	PFAM
low complexity region	2329	2341	N/A	INTRINSIC
low complexity region	2473	2482	N/A	INTRINSIC
low complexity region	2485	2500	N/A	INTRINSIC
low complexity region	2523	2534	N/A	INTRINSIC
coiled coil region	2625	2649	N/A	INTRINSIC
low complexity region	2827	2841	N/A	INTRINSIC
coiled coil region	2854	2893	N/A	INTRINSIC
coiled coil region	2963	2989	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000101127

SMART Domains

Protein: ENSMUSP00000098687
Gene: ENSMUSG00000070733

Domain	Start	End	E-Value	Type
Pfam:MOR2-PAG1_N	116	649	3e-172	PFAM
low complexity region	873	884	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	898	1115	7.8e-6	PFAM
Pfam:MOR2-PAG1_mid	1147	1331	9.5e-19	PFAM
Pfam:MOR2-PAG1_mid	1351	1503	1.1e-5	PFAM
low complexity region	1530	1548	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	1589	1664	6e-6	PFAM
Pfam:MOR2-PAG1_mid	1725	1866	1.6e-14	PFAM
low complexity region	1973	1984	N/A	INTRINSIC
Pfam:MOR2-PAG1_C	1998	2260	4.4e-76	PFAM
low complexity region	2329	2341	N/A	INTRINSIC
low complexity region	2473	2482	N/A	INTRINSIC
low complexity region	2485	2500	N/A	INTRINSIC
low complexity region	2523	2534	N/A	INTRINSIC
coiled coil region	2625	2649	N/A	INTRINSIC
low complexity region	2827	2841	N/A	INTRINSIC
coiled coil region	2854	2893	N/A	INTRINSIC
coiled coil region	2963	2989	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000152631
AA Change: *125R

SMART Domains

Protein: ENSMUSP00000115208
Gene: ENSMUSG00000070733
AA Change: *125R

Domain	Start	End	E-Value	Type
Pfam:MOR2-PAG1_N	1	117	5.3e-40	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000153903

SMART Domains

Protein: ENSMUSP00000119385
Gene: ENSMUSG00000070733

Domain	Start	End	E-Value	Type
Pfam:MOR2-PAG1_N	1	199	4.4e-58	PFAM

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

100% (43/43)

MGI Phenotype

PHENOTYPE: Most mice homozygous for a knock-out allele exhibit postnatal lethality and defects in kidney development; rare survivors display growth retardation, decreased body weight, and premature death associated with chronic hydronephrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adora2b	T	A	11: 62,249,315	C72S	probably damaging	Het
Atcay	T	C	10: 81,212,948	Y183C	probably damaging	Het
Atp1a1	A	T	3: 101,586,904	I460N	probably damaging	Het
Celf4	T	C	18: 25,504,270	S223G	possibly damaging	Het
Ces2c	T	A	8: 104,848,082	V57D	probably damaging	Het
Ces2f	T	C	8: 104,948,176	V70A	possibly damaging	Het
Cntnap1	C	T	11: 101,177,590	P114S	probably damaging	Het
Cpsf1	A	G	15: 76,600,283	F666S	probably damaging	Het
Cuzd1	T	A	7: 131,311,568	D440V	probably damaging	Het
Dhx57	T	C	17: 80,278,289	E107G	probably damaging	Het
Dopey1	G	T	9: 86,500,872	R286L	probably damaging	Het
Fam135a	G	A	1: 24,028,827	T987I	probably benign	Het
Fastkd1	G	T	2: 69,687,081	Y818*	probably null	Het
Fer1l4	A	C	2: 156,052,243	F47V	possibly damaging	Het
Gm5096	C	T	18: 87,757,451	S366F	probably damaging	Het
Herc6	A	G	6: 57,583,206	D77G	probably benign	Het
Hmox1	T	C	8: 75,097,331	L209P	probably damaging	Het
Kcns3	A	T	12: 11,091,653	D348E	probably benign	Het
Lama1	T	A	17: 67,745,923	I417N		Het
Lmo7	T	C	14: 101,902,364	S1028P	probably benign	Het
Lrrc37a	C	G	11: 103,501,585	E1005Q	probably benign	Het
Mis18bp1	A	T	12: 65,154,811	I372K	possibly damaging	Het
Nr4a3	A	G	4: 48,051,348	D34G	probably damaging	Het
Olfr1218	A	T	2: 89,054,604	V274D	probably benign	Het
Parp12	T	C	6: 39,091,345	D496G	probably benign	Het
Rom1	A	G	19: 8,927,880	V282A	probably benign	Het
Rp1l1	G	A	14: 64,028,809	V615I	probably benign	Het
Rpgrip1	A	G	14: 52,152,201		probably null	Het
Ryr2	A	G	13: 11,684,478	I2959T	possibly damaging	Het
Sema4a	T	G	3: 88,452,034	K117Q	probably damaging	Het
Slc22a29	A	G	19: 8,161,640	M486T	possibly damaging	Het
Sntb2	T	A	8: 107,001,534	C371*	probably null	Het
Spata31d1c	A	G	13: 65,036,230	T529A	probably benign	Het
Tchp	G	T	5: 114,708,766	R38L	possibly damaging	Het
Tnpo2	T	C	8: 85,047,297	V320A	probably benign	Het
Trim50	A	T	5: 135,363,792	D187V	probably damaging	Het
Ttl	A	G	2: 129,081,243	E168G	possibly damaging	Het
Tuba1c	T	A	15: 99,034,104	I5N	probably damaging	Het
Tyr	C	T	7: 87,437,967	G446R	probably damaging	Het
Vps35	C	T	8: 85,274,858	V444I	probably benign	Het
Vstm2b	T	C	7: 40,902,475	S76P	probably damaging	Het

Other mutations in Fryl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00819:Fryl	APN	5	73148108	missense	possibly damaging	0.92
IGL01518:Fryl	APN	5	73086962	missense	possibly damaging	0.76
IGL01545:Fryl	APN	5	73054597	missense	probably damaging	1.00
IGL01646:Fryl	APN	5	73022501	critical splice donor site	probably null
IGL01938:Fryl	APN	5	73122364	missense	probably damaging	0.98
IGL01962:Fryl	APN	5	73032791	missense	possibly damaging	0.62
IGL02064:Fryl	APN	5	73124769	unclassified	probably benign
IGL02148:Fryl	APN	5	73075959	missense	probably benign	0.35
IGL02418:Fryl	APN	5	73110176	splice site	probably benign
IGL02431:Fryl	APN	5	73098308	missense	probably benign	0.02
IGL02513:Fryl	APN	5	73065293	missense	probably damaging	1.00
IGL02557:Fryl	APN	5	73098393	missense	probably damaging	1.00
IGL02625:Fryl	APN	5	73069877	intron	probably benign
IGL02642:Fryl	APN	5	73095466	missense	probably benign
IGL02657:Fryl	APN	5	73054860	missense	probably benign	0.01
IGL02706:Fryl	APN	5	73093163	missense	probably benign	0.45
IGL03022:Fryl	APN	5	73059383	missense	possibly damaging	0.82
IGL03144:Fryl	APN	5	73101455	missense	probably null	0.22
IGL03155:Fryl	APN	5	73076695	missense	probably benign
IGL03183:Fryl	APN	5	73076695	missense	probably benign
IGL03275:Fryl	APN	5	73148033	missense	possibly damaging	0.47
IGL03310:Fryl	APN	5	73136316	splice site	probably benign
IGL03341:Fryl	APN	5	73076695	missense	probably benign
IGL03343:Fryl	APN	5	73076695	missense	probably benign
IGL03350:Fryl	APN	5	73133306	missense	probably damaging	0.99
IGL03357:Fryl	APN	5	73054059	missense	probably damaging	1.00
IGL03374:Fryl	APN	5	73110281	splice site	probably benign
IGL03375:Fryl	APN	5	73088449	missense	possibly damaging	0.91
bedeviled	UTSW	5	73059500	missense	probably damaging	1.00
Besotted	UTSW	5	73072912	missense	probably damaging	1.00
R0062:Fryl	UTSW	5	73022278	missense	probably benign	0.02
R0062:Fryl	UTSW	5	73022278	missense	probably benign	0.02
R0308:Fryl	UTSW	5	73041604	splice site	probably benign
R0312:Fryl	UTSW	5	73072888	missense	probably damaging	1.00
R0415:Fryl	UTSW	5	73098414	missense	probably damaging	0.99
R0440:Fryl	UTSW	5	73086972	missense	possibly damaging	0.91
R0446:Fryl	UTSW	5	73097417	missense	possibly damaging	0.91
R0566:Fryl	UTSW	5	73064497	splice site	probably benign
R0567:Fryl	UTSW	5	73065391	missense	possibly damaging	0.50
R0606:Fryl	UTSW	5	73124734	missense	probably benign	0.15
R0619:Fryl	UTSW	5	73068731	missense	probably benign	0.22
R0654:Fryl	UTSW	5	73083372	missense	probably benign	0.17
R0658:Fryl	UTSW	5	73065359	missense	probably damaging	1.00
R0707:Fryl	UTSW	5	73083372	missense	probably benign	0.17
R0744:Fryl	UTSW	5	73089081	unclassified	probably benign
R0745:Fryl	UTSW	5	73071126	missense	probably damaging	0.96
R0833:Fryl	UTSW	5	73089081	unclassified	probably benign
R0885:Fryl	UTSW	5	73089196	missense	probably damaging	0.97
R0894:Fryl	UTSW	5	73041332	splice site	probably benign
R1076:Fryl	UTSW	5	73124673	unclassified	probably benign
R1241:Fryl	UTSW	5	73064925	splice site	probably benign
R1241:Fryl	UTSW	5	73110271	missense	probably damaging	1.00
R1394:Fryl	UTSW	5	73072912	missense	probably damaging	1.00
R1395:Fryl	UTSW	5	73072912	missense	probably damaging	1.00
R1608:Fryl	UTSW	5	73074751	nonsense	probably null
R1664:Fryl	UTSW	5	73059435	missense	probably damaging	1.00
R1745:Fryl	UTSW	5	73032861	splice site	probably benign
R1937:Fryl	UTSW	5	73133367	missense	probably damaging	1.00
R1969:Fryl	UTSW	5	73098266	missense	probably benign	0.18
R1993:Fryl	UTSW	5	73108493	missense	probably damaging	1.00
R1994:Fryl	UTSW	5	73108493	missense	probably damaging	1.00
R2029:Fryl	UTSW	5	73022122	nonsense	probably null
R2036:Fryl	UTSW	5	73022544	missense	probably benign
R2036:Fryl	UTSW	5	73107962	critical splice donor site	probably null
R2088:Fryl	UTSW	5	73065461	missense	probably benign	0.02
R2105:Fryl	UTSW	5	73122299	missense	probably benign
R2106:Fryl	UTSW	5	73098331	missense	probably damaging	1.00
R2186:Fryl	UTSW	5	73064975	missense	probably damaging	1.00
R2239:Fryl	UTSW	5	73108547	missense	probably damaging	0.99
R2256:Fryl	UTSW	5	73072844	missense	possibly damaging	0.47
R2257:Fryl	UTSW	5	73072844	missense	possibly damaging	0.47
R2280:Fryl	UTSW	5	73041364	missense	possibly damaging	0.47
R2281:Fryl	UTSW	5	73041364	missense	possibly damaging	0.47
R2911:Fryl	UTSW	5	73050456	missense	probably damaging	0.99
R3019:Fryl	UTSW	5	73082850	missense	probably benign	0.01
R3416:Fryl	UTSW	5	73108074	missense	possibly damaging	0.84
R3783:Fryl	UTSW	5	73101476	missense	probably benign
R3787:Fryl	UTSW	5	73101476	missense	probably benign
R3837:Fryl	UTSW	5	73071265	missense	probably benign	0.03
R3969:Fryl	UTSW	5	73112423	missense	probably damaging	0.97
R4387:Fryl	UTSW	5	73086560	missense	possibly damaging	0.91
R4502:Fryl	UTSW	5	73088397	missense	probably damaging	1.00
R4658:Fryl	UTSW	5	73081053	missense	probably damaging	1.00
R4664:Fryl	UTSW	5	73090679	missense	possibly damaging	0.80
R4690:Fryl	UTSW	5	73100293	missense	probably benign
R4700:Fryl	UTSW	5	73065538	missense	possibly damaging	0.88
R4709:Fryl	UTSW	5	73080972	missense	probably benign	0.03
R4807:Fryl	UTSW	5	73041362	missense	probably benign	0.00
R4912:Fryl	UTSW	5	73068782	frame shift	probably null
R4948:Fryl	UTSW	5	73089130	missense	probably benign	0.08
R4959:Fryl	UTSW	5	73035058	missense	probably benign	0.00
R5062:Fryl	UTSW	5	73075893	missense	possibly damaging	0.89
R5067:Fryl	UTSW	5	73057755	missense	probably benign	0.13
R5071:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5072:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5073:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5074:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5139:Fryl	UTSW	5	73090718	missense	probably damaging	1.00
R5172:Fryl	UTSW	5	73101673	missense	possibly damaging	0.95
R5187:Fryl	UTSW	5	73086600	missense	possibly damaging	0.95
R5272:Fryl	UTSW	5	73065136	nonsense	probably null
R5275:Fryl	UTSW	5	73112791	missense	probably damaging	1.00
R5295:Fryl	UTSW	5	73112791	missense	probably damaging	1.00
R5344:Fryl	UTSW	5	73104774	missense	probably damaging	1.00
R5355:Fryl	UTSW	5	73073904	missense	probably damaging	1.00
R5716:Fryl	UTSW	5	73100465	missense	probably benign
R5778:Fryl	UTSW	5	73072778	missense	probably damaging	1.00
R5810:Fryl	UTSW	5	73090755	missense	probably benign	0.06
R5934:Fryl	UTSW	5	73090717	missense	probably damaging	1.00
R5948:Fryl	UTSW	5	73097372	critical splice donor site	probably null
R6005:Fryl	UTSW	5	73083295	missense	probably damaging	1.00
R6026:Fryl	UTSW	5	73099997	missense	probably benign	0.04
R6045:Fryl	UTSW	5	73118551	missense	probably damaging	0.99
R6185:Fryl	UTSW	5	73112788	missense	probably benign	0.43
R6247:Fryl	UTSW	5	73065481	missense	probably damaging	0.98
R6294:Fryl	UTSW	5	73191759	intron	probably benign
R6310:Fryl	UTSW	5	73191761	intron	probably benign
R6429:Fryl	UTSW	5	73090751	missense	possibly damaging	0.84
R6568:Fryl	UTSW	5	73059516	missense	probably damaging	1.00
R6636:Fryl	UTSW	5	73133312	missense	probably benign	0.01
R6664:Fryl	UTSW	5	73132481	missense	probably damaging	1.00
R6732:Fryl	UTSW	5	73054781	missense	probably damaging	1.00
R6750:Fryl	UTSW	5	73022232	missense	probably damaging	1.00
R6805:Fryl	UTSW	5	73065094	missense	probably benign	0.03
R6823:Fryl	UTSW	5	73065217	missense	probably damaging	0.99
R6855:Fryl	UTSW	5	73059500	missense	probably damaging	1.00
R6858:Fryl	UTSW	5	73065032	missense	probably damaging	1.00
R6868:Fryl	UTSW	5	73068803	missense	probably damaging	1.00
R6898:Fryl	UTSW	5	73022142	missense	probably damaging	0.96
R6908:Fryl	UTSW	5	73022211	missense	probably damaging	1.00
R6958:Fryl	UTSW	5	73073929	missense	possibly damaging	0.89
R6980:Fryl	UTSW	5	73050430	missense	probably benign	0.06
R7036:Fryl	UTSW	5	73055608	missense	probably benign	0.03
R7065:Fryl	UTSW	5	73090756	missense	probably damaging	0.96
R7097:Fryl	UTSW	5	73073908	missense	probably benign	0.31
R7171:Fryl	UTSW	5	73122310	missense	probably damaging	0.97
R7191:Fryl	UTSW	5	73072912	missense	probably damaging	1.00
R7207:Fryl	UTSW	5	73065095	missense	probably benign
R7236:Fryl	UTSW	5	73108478	missense	possibly damaging	0.66
R7334:Fryl	UTSW	5	73047496	splice site	probably null
R7425:Fryl	UTSW	5	73104748	missense	probably damaging	1.00
R7452:Fryl	UTSW	5	73023988	missense	probably damaging	1.00
R7479:Fryl	UTSW	5	73097561	missense	possibly damaging	0.71
R7535:Fryl	UTSW	5	73098196	missense	probably benign	0.15
R7538:Fryl	UTSW	5	73022676	missense	probably benign	0.09
R7544:Fryl	UTSW	5	73081039	missense	probably benign
R7548:Fryl	UTSW	5	73191762	missense	unknown
R7565:Fryl	UTSW	5	73033720	missense	probably benign	0.18
R7572:Fryl	UTSW	5	73088396	missense	possibly damaging	0.91
R7582:Fryl	UTSW	5	73022500	critical splice donor site	probably null
R7630:Fryl	UTSW	5	73110245	missense	possibly damaging	0.62
R7774:Fryl	UTSW	5	73083384	missense	probably benign	0.12
R7777:Fryl	UTSW	5	73071298	missense	probably damaging	0.98
R7917:Fryl	UTSW	5	73054532	missense	probably damaging	1.00
R7920:Fryl	UTSW	5	73101807	splice site	probably null
R8110:Fryl	UTSW	5	73133277	missense	probably benign	0.10
R8120:Fryl	UTSW	5	73071184	missense	probably benign	0.01
R8143:Fryl	UTSW	5	73050339	missense	probably benign	0.00
R8207:Fryl	UTSW	5	73100500	splice site	probably null
R8263:Fryl	UTSW	5	73081005	missense	probably damaging	1.00
R8350:Fryl	UTSW	5	73068730	missense	probably benign
R8359:Fryl	UTSW	5	73075933	missense	probably benign	0.39
R8387:Fryl	UTSW	5	73136320	critical splice donor site	probably null
R8450:Fryl	UTSW	5	73068730	missense	probably benign
R8514:Fryl	UTSW	5	73085356	missense	probably benign
R8536:Fryl	UTSW	5	73100353	missense	probably damaging	0.99
R8703:Fryl	UTSW	5	73090654	missense	probably damaging	0.99
R8708:Fryl	UTSW	5	73132562	missense	probably benign	0.01
R8783:Fryl	UTSW	5	73068842	missense	probably benign	0.45
R9028:Fryl	UTSW	5	73098266	missense	probably benign	0.18
R9045:Fryl	UTSW	5	73024775	missense
R9063:Fryl	UTSW	5	73081003	missense	possibly damaging	0.70
R9096:Fryl	UTSW	5	73108577	missense	probably benign	0.01
R9345:Fryl	UTSW	5	73050411	missense	probably benign
R9381:Fryl	UTSW	5	73083294	missense	probably benign	0.24
R9386:Fryl	UTSW	5	73191809	missense	unknown
R9401:Fryl	UTSW	5	73065220	nonsense	probably null
R9497:Fryl	UTSW	5	73057791	missense
R9514:Fryl	UTSW	5	73104772	missense	probably damaging	1.00
R9570:Fryl	UTSW	5	73022155	missense	not run
Z1088:Fryl	UTSW	5	73090709	missense	probably damaging	0.99
Z1088:Fryl	UTSW	5	73090738	missense	probably damaging	1.00
Z1176:Fryl	UTSW	5	73072837	missense	probably benign
Z1177:Fryl	UTSW	5	73041595	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GAGCCAACATTACGGAACTTTC -3'
(R):5'- ACCTTGCCGTAAAGAGTGTTAATTC -3'

Sequencing Primer
(F):5'- CCTACATGAAGGGTTTTATGAGAC -3'
(R):5'- CAGGCTTTGTACCCACTAAT -3'

Posted On

2020-10-20