Incidental Mutation 'R8404:Pced1a'
ID 652302
Institutional Source Beutler Lab
Gene Symbol Pced1a
Ensembl Gene ENSMUSG00000037773
Gene Name PC-esterase domain containing 1A
Synonyms Fam113a, A930025D01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8404 (G1)
Quality Score 198.009
Status Not validated
Chromosome 2
Chromosomal Location 130417247-130424701 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 130423657 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000089581] [ENSMUST00000110277] [ENSMUST00000128994]
AlphaFold Q6P1Z5
Predicted Effect probably benign
Transcript: ENSMUST00000028900
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089581
SMART Domains Protein: ENSMUSP00000087009
Gene: ENSMUSG00000037773

DomainStartEndE-ValueType
Pfam:PC-Esterase 18 267 4e-52 PFAM
low complexity region 308 346 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110277
SMART Domains Protein: ENSMUSP00000105906
Gene: ENSMUSG00000037773

DomainStartEndE-ValueType
Pfam:PC-Esterase 21 268 3.8e-51 PFAM
low complexity region 308 346 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128994
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the GDSL/SGNH superfamily. Members of this family are hydrolytic enzymes with esterase and lipase activity and broad substrate specificity. This protein belongs to the Pmr5-Cas1p-esterase subfamily in that it contains the catalytic triad comprised of serine, aspartate and histidine and lacks two conserved regions (glycine after strand S2 and GxND motif). A pseudogene of this gene has been identified on the long arm of chromosome 2. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Abca6 T A 11: 110,219,319 L599F probably damaging Het
Accs T C 2: 93,838,115 Y337C probably damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Apcdd1 A T 18: 62,933,915 R33S possibly damaging Het
Brsk1 T C 7: 4,706,696 S441P probably damaging Het
Crlf2 T C 5: 109,557,051 D98G probably benign Het
Dnah10 A G 5: 124,773,542 D1693G probably damaging Het
Gfm2 T C 13: 97,162,977 I402T probably benign Het
Gm6899 C G 11: 26,593,630 R66G unknown Het
Hira T G 16: 18,952,162 S850A possibly damaging Het
Krt10 C T 11: 99,387,533 E267K probably damaging Het
Lama5 T C 2: 180,195,222 N1074S probably damaging Het
Lrp2 C T 2: 69,514,241 W844* probably null Het
Maml3 T C 3: 51,690,656 Y869C probably damaging Het
Nap1l1 T A 10: 111,481,301 M1K probably null Het
Nbeal2 C T 9: 110,634,389 S1258N possibly damaging Het
Olfr561 T A 7: 102,774,927 Y134* probably null Het
Pam T C 1: 97,895,633 Q271R probably damaging Het
Pdcd11 T C 19: 47,104,792 V503A probably damaging Het
Pinx1 T A 14: 63,919,614 V330D unknown Het
Prdm2 T C 4: 143,135,014 I569V probably damaging Het
Prickle2 T C 6: 92,420,321 D197G probably damaging Het
Prmt8 C T 6: 127,689,862 C383Y possibly damaging Het
Prss42 T C 9: 110,800,916 L246P probably damaging Het
Ptpra C A 2: 130,549,759 D732E probably damaging Het
Rpp30 T C 19: 36,089,203 L112P probably damaging Het
Saraf C T 8: 34,165,448 P227L probably benign Het
Slc22a28 A T 19: 8,131,429 C116* probably null Het
Slc45a2 T C 15: 11,027,872 I509T possibly damaging Het
Spag7 T C 11: 70,669,233 S17G probably benign Het
Trim62 A G 4: 128,909,440 I428V probably benign Het
Urb2 A G 8: 124,025,203 T92A probably damaging Het
Zan A T 5: 137,398,332 C4321S unknown Het
Zbtb32 G A 7: 30,591,610 P87S possibly damaging Het
Zer1 C T 2: 30,105,023 probably null Het
Zfat T C 15: 68,105,067 T1078A probably benign Het
Other mutations in Pced1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Pced1a APN 2 130419178 missense probably benign 0.00
IGL02173:Pced1a APN 2 130422328 missense possibly damaging 0.46
IGL02547:Pced1a APN 2 130419707 missense possibly damaging 0.74
IGL02729:Pced1a APN 2 130421903 missense probably benign 0.01
IGL03107:Pced1a APN 2 130422835 missense possibly damaging 0.81
R0139:Pced1a UTSW 2 130421907 missense probably benign 0.00
R0550:Pced1a UTSW 2 130419633 missense probably benign 0.00
R0578:Pced1a UTSW 2 130419843 missense probably damaging 0.98
R3037:Pced1a UTSW 2 130419859 missense probably benign 0.40
R3157:Pced1a UTSW 2 130419767 missense probably benign 0.12
R4578:Pced1a UTSW 2 130422676 missense probably damaging 1.00
R5306:Pced1a UTSW 2 130419171 missense probably benign
R6210:Pced1a UTSW 2 130421919 missense probably damaging 1.00
R7444:Pced1a UTSW 2 130422059 missense probably damaging 0.98
R7459:Pced1a UTSW 2 130419824 missense possibly damaging 0.59
R7524:Pced1a UTSW 2 130422028 missense probably benign 0.44
R7744:Pced1a UTSW 2 130422052 missense probably damaging 1.00
R7782:Pced1a UTSW 2 130422515 missense probably damaging 0.99
R7851:Pced1a UTSW 2 130422316 missense probably damaging 0.99
R8300:Pced1a UTSW 2 130424237 unclassified probably benign
R8502:Pced1a UTSW 2 130423657 unclassified probably benign
R8990:Pced1a UTSW 2 130422551 missense probably damaging 1.00
Z1177:Pced1a UTSW 2 130422628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCTGAGGCATGGAAGTGG -3'
(R):5'- GAGAGACTTGGTAACTGGCG -3'

Sequencing Primer
(F):5'- AAGTGGACCATGGCGCTTC -3'
(R):5'- CGCGAGCGGACGAATGC -3'
Posted On 2020-10-20