Mutagenetix > Incidental Mutations

Incidental Mutation 'R8404:Pced1a'

652302

Institutional Source

Beutler Lab

Gene Symbol

Pced1a

Ensembl Gene

ENSMUSG00000037773

Gene Name

PC-esterase domain containing 1A

Synonyms

Fam113a, A930025D01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8404 (G1)

Quality Score

198.009

Status

Not validated

Chromosome

Chromosomal Location

130417247-130424701 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 130423657 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000115899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000089581] [ENSMUST00000110277] [ENSMUST00000128994]

AlphaFold

Q6P1Z5

Predicted Effect

probably benign
Transcript: ENSMUST00000028900

SMART Domains

Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411

Domain	Start	End	E-Value	Type
Pfam:Vps16_N	4	420	1e-166	PFAM
low complexity region	452	462	N/A	INTRINSIC
Pfam:Vps16_C	517	835	5.5e-150	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000089581

SMART Domains

Protein: ENSMUSP00000087009
Gene: ENSMUSG00000037773

Domain	Start	End	E-Value	Type
Pfam:PC-Esterase	18	267	4e-52	PFAM
low complexity region	308	346	N/A	INTRINSIC
low complexity region	376	391	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110277

SMART Domains

Protein: ENSMUSP00000105906
Gene: ENSMUSG00000037773

Domain	Start	End	E-Value	Type
Pfam:PC-Esterase	21	268	3.8e-51	PFAM
low complexity region	308	346	N/A	INTRINSIC
low complexity region	376	391	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000128994

SMART Domains

Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

Domain	Start	End	E-Value	Type
Pfam:Vps16_N	4	212	3.2e-74	PFAM
Pfam:Vps16_N	205	316	1e-45	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the GDSL/SGNH superfamily. Members of this family are hydrolytic enzymes with esterase and lipase activity and broad substrate specificity. This protein belongs to the Pmr5-Cas1p-esterase subfamily in that it contains the catalytic triad comprised of serine, aspartate and histidine and lacks two conserved regions (glycine after strand S2 and GxND motif). A pseudogene of this gene has been identified on the long arm of chromosome 2. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Sep 2012]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	C	A	17: 33,067,064	A255S	probably benign	Het
Abca6	T	A	11: 110,219,319	L599F	probably damaging	Het
Accs	T	C	2: 93,838,115	Y337C	probably damaging	Het
Alkal2	G	T	12: 30,884,851	G23V	probably damaging	Het
Apcdd1	A	T	18: 62,933,915	R33S	possibly damaging	Het
Brsk1	T	C	7: 4,706,696	S441P	probably damaging	Het
Crlf2	T	C	5: 109,557,051	D98G	probably benign	Het
Dnah10	A	G	5: 124,773,542	D1693G	probably damaging	Het
Gfm2	T	C	13: 97,162,977	I402T	probably benign	Het
Gm6899	C	G	11: 26,593,630	R66G	unknown	Het
Hira	T	G	16: 18,952,162	S850A	possibly damaging	Het
Krt10	C	T	11: 99,387,533	E267K	probably damaging	Het
Lama5	T	C	2: 180,195,222	N1074S	probably damaging	Het
Lrp2	C	T	2: 69,514,241	W844*	probably null	Het
Maml3	T	C	3: 51,690,656	Y869C	probably damaging	Het
Nap1l1	T	A	10: 111,481,301	M1K	probably null	Het
Nbeal2	C	T	9: 110,634,389	S1258N	possibly damaging	Het
Olfr561	T	A	7: 102,774,927	Y134*	probably null	Het
Pam	T	C	1: 97,895,633	Q271R	probably damaging	Het
Pdcd11	T	C	19: 47,104,792	V503A	probably damaging	Het
Pinx1	T	A	14: 63,919,614	V330D	unknown	Het
Prdm2	T	C	4: 143,135,014	I569V	probably damaging	Het
Prickle2	T	C	6: 92,420,321	D197G	probably damaging	Het
Prmt8	C	T	6: 127,689,862	C383Y	possibly damaging	Het
Prss42	T	C	9: 110,800,916	L246P	probably damaging	Het
Ptpra	C	A	2: 130,549,759	D732E	probably damaging	Het
Rpp30	T	C	19: 36,089,203	L112P	probably damaging	Het
Saraf	C	T	8: 34,165,448	P227L	probably benign	Het
Slc22a28	A	T	19: 8,131,429	C116*	probably null	Het
Slc45a2	T	C	15: 11,027,872	I509T	possibly damaging	Het
Spag7	T	C	11: 70,669,233	S17G	probably benign	Het
Trim62	A	G	4: 128,909,440	I428V	probably benign	Het
Urb2	A	G	8: 124,025,203	T92A	probably damaging	Het
Zan	A	T	5: 137,398,332	C4321S	unknown	Het
Zbtb32	G	A	7: 30,591,610	P87S	possibly damaging	Het
Zer1	C	T	2: 30,105,023		probably null	Het
Zfat	T	C	15: 68,105,067	T1078A	probably benign	Het

Other mutations in Pced1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Pced1a	APN	2	130419178	missense	probably benign	0.00
IGL02173:Pced1a	APN	2	130422328	missense	possibly damaging	0.46
IGL02547:Pced1a	APN	2	130419707	missense	possibly damaging	0.74
IGL02729:Pced1a	APN	2	130421903	missense	probably benign	0.01
IGL03107:Pced1a	APN	2	130422835	missense	possibly damaging	0.81
R0139:Pced1a	UTSW	2	130421907	missense	probably benign	0.00
R0550:Pced1a	UTSW	2	130419633	missense	probably benign	0.00
R0578:Pced1a	UTSW	2	130419843	missense	probably damaging	0.98
R3037:Pced1a	UTSW	2	130419859	missense	probably benign	0.40
R3157:Pced1a	UTSW	2	130419767	missense	probably benign	0.12
R4578:Pced1a	UTSW	2	130422676	missense	probably damaging	1.00
R5306:Pced1a	UTSW	2	130419171	missense	probably benign
R6210:Pced1a	UTSW	2	130421919	missense	probably damaging	1.00
R7444:Pced1a	UTSW	2	130422059	missense	probably damaging	0.98
R7459:Pced1a	UTSW	2	130419824	missense	possibly damaging	0.59
R7524:Pced1a	UTSW	2	130422028	missense	probably benign	0.44
R7744:Pced1a	UTSW	2	130422052	missense	probably damaging	1.00
R7782:Pced1a	UTSW	2	130422515	missense	probably damaging	0.99
R7851:Pced1a	UTSW	2	130422316	missense	probably damaging	0.99
R8300:Pced1a	UTSW	2	130424237	unclassified	probably benign
R8502:Pced1a	UTSW	2	130423657	unclassified	probably benign
R8990:Pced1a	UTSW	2	130422551	missense	probably damaging	1.00
Z1177:Pced1a	UTSW	2	130422628	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTCTGAGGCATGGAAGTGG -3'
(R):5'- GAGAGACTTGGTAACTGGCG -3'

Sequencing Primer
(F):5'- AAGTGGACCATGGCGCTTC -3'
(R):5'- CGCGAGCGGACGAATGC -3'

Posted On

2020-10-20