Incidental Mutation 'R8404:Or51f5'
ID 652315
Institutional Source Beutler Lab
Gene Symbol Or51f5
Ensembl Gene ENSMUSG00000073966
Gene Name olfactory receptor family 51 subfamily F member 5
Synonyms GA_x6K02T2PBJ9-5491151-5492095, Olfr561, MOR14-2
MMRRC Submission 067764-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.192) question?
Stock # R8404 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 102423733-102424677 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 102424134 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 134 (Y134*)
Ref Sequence ENSEMBL: ENSMUSP00000150963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098217] [ENSMUST00000213432]
AlphaFold Q8VGZ6
Predicted Effect probably null
Transcript: ENSMUST00000098217
AA Change: Y134*
SMART Domains Protein: ENSMUSP00000095819
Gene: ENSMUSG00000073966
AA Change: Y134*

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 5.1e-122 PFAM
Pfam:7TM_GPCR_Srsx 37 259 9.6e-8 PFAM
Pfam:7tm_1 43 294 4.4e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213432
AA Change: Y134*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,110,145 (GRCm39) L599F probably damaging Het
Accs T C 2: 93,668,460 (GRCm39) Y337C probably damaging Het
Alkal2 G T 12: 30,934,850 (GRCm39) G23V probably damaging Het
Apcdd1 A T 18: 63,066,986 (GRCm39) R33S possibly damaging Het
Brsk1 T C 7: 4,709,695 (GRCm39) S441P probably damaging Het
Crlf2 T C 5: 109,704,917 (GRCm39) D98G probably benign Het
Dnah10 A G 5: 124,850,606 (GRCm39) D1693G probably damaging Het
Gfm2 T C 13: 97,299,485 (GRCm39) I402T probably benign Het
Gm6899 C G 11: 26,543,630 (GRCm39) R66G unknown Het
Hira T G 16: 18,770,912 (GRCm39) S850A possibly damaging Het
Krt10 C T 11: 99,278,359 (GRCm39) E267K probably damaging Het
Lama5 T C 2: 179,837,015 (GRCm39) N1074S probably damaging Het
Lrp2 C T 2: 69,344,585 (GRCm39) W844* probably null Het
Maml3 T C 3: 51,598,077 (GRCm39) Y869C probably damaging Het
Nap1l1 T A 10: 111,317,162 (GRCm39) M1K probably null Het
Nbeal2 C T 9: 110,463,457 (GRCm39) S1258N possibly damaging Het
Pam T C 1: 97,823,358 (GRCm39) Q271R probably damaging Het
Pced1a T C 2: 130,265,577 (GRCm39) probably benign Het
Pdcd11 T C 19: 47,093,231 (GRCm39) V503A probably damaging Het
Phf8-ps C A 17: 33,286,038 (GRCm39) A255S probably benign Het
Pinx1 T A 14: 64,157,063 (GRCm39) V330D unknown Het
Prdm2 T C 4: 142,861,584 (GRCm39) I569V probably damaging Het
Prickle2 T C 6: 92,397,302 (GRCm39) D197G probably damaging Het
Prmt8 C T 6: 127,666,825 (GRCm39) C383Y possibly damaging Het
Prss42 T C 9: 110,629,984 (GRCm39) L246P probably damaging Het
Ptpra C A 2: 130,391,679 (GRCm39) D732E probably damaging Het
Rpp30 T C 19: 36,066,603 (GRCm39) L112P probably damaging Het
Saraf C T 8: 34,632,602 (GRCm39) P227L probably benign Het
Slc22a28 A T 19: 8,108,793 (GRCm39) C116* probably null Het
Slc45a2 T C 15: 11,027,958 (GRCm39) I509T possibly damaging Het
Spag7 T C 11: 70,560,059 (GRCm39) S17G probably benign Het
Trim62 A G 4: 128,803,233 (GRCm39) I428V probably benign Het
Urb2 A G 8: 124,751,942 (GRCm39) T92A probably damaging Het
Zan A T 5: 137,396,594 (GRCm39) C4321S unknown Het
Zbtb32 G A 7: 30,291,035 (GRCm39) P87S possibly damaging Het
Zer1 C T 2: 29,995,035 (GRCm39) probably null Het
Zfat T C 15: 67,976,916 (GRCm39) T1078A probably benign Het
Other mutations in Or51f5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Or51f5 APN 7 102,424,114 (GRCm39) missense probably damaging 0.99
IGL02743:Or51f5 APN 7 102,424,505 (GRCm39) missense probably damaging 0.99
IGL03001:Or51f5 APN 7 102,424,460 (GRCm39) missense probably damaging 0.98
R0254:Or51f5 UTSW 7 102,424,076 (GRCm39) nonsense probably null
R0356:Or51f5 UTSW 7 102,424,286 (GRCm39) missense probably damaging 1.00
R0514:Or51f5 UTSW 7 102,424,539 (GRCm39) missense probably benign 0.00
R0725:Or51f5 UTSW 7 102,423,739 (GRCm39) missense probably benign
R0739:Or51f5 UTSW 7 102,423,872 (GRCm39) missense probably damaging 1.00
R1900:Or51f5 UTSW 7 102,424,538 (GRCm39) missense probably benign 0.19
R2080:Or51f5 UTSW 7 102,424,450 (GRCm39) missense probably benign 0.02
R2212:Or51f5 UTSW 7 102,423,962 (GRCm39) missense possibly damaging 0.77
R2379:Or51f5 UTSW 7 102,424,052 (GRCm39) missense probably benign 0.33
R3412:Or51f5 UTSW 7 102,423,962 (GRCm39) missense possibly damaging 0.77
R3834:Or51f5 UTSW 7 102,424,493 (GRCm39) missense probably damaging 1.00
R4117:Or51f5 UTSW 7 102,423,684 (GRCm39) splice site probably null
R4363:Or51f5 UTSW 7 102,424,463 (GRCm39) missense probably benign 0.34
R4401:Or51f5 UTSW 7 102,424,006 (GRCm39) nonsense probably null
R5176:Or51f5 UTSW 7 102,424,513 (GRCm39) missense probably damaging 0.99
R5464:Or51f5 UTSW 7 102,424,640 (GRCm39) missense probably benign 0.00
R5465:Or51f5 UTSW 7 102,424,640 (GRCm39) missense probably benign 0.00
R5493:Or51f5 UTSW 7 102,424,315 (GRCm39) missense probably benign 0.00
R5540:Or51f5 UTSW 7 102,424,136 (GRCm39) missense probably benign 0.02
R5629:Or51f5 UTSW 7 102,423,847 (GRCm39) missense possibly damaging 0.63
R6227:Or51f5 UTSW 7 102,423,883 (GRCm39) missense probably damaging 0.98
R6367:Or51f5 UTSW 7 102,424,036 (GRCm39) missense possibly damaging 0.92
R6497:Or51f5 UTSW 7 102,424,657 (GRCm39) missense probably benign 0.00
R7219:Or51f5 UTSW 7 102,430,913 (GRCm39) missense probably benign 0.00
R7243:Or51f5 UTSW 7 102,430,865 (GRCm39) missense probably benign
R7289:Or51f5 UTSW 7 102,424,634 (GRCm39) missense probably damaging 1.00
R7560:Or51f5 UTSW 7 102,430,889 (GRCm39) missense probably damaging 1.00
R7731:Or51f5 UTSW 7 102,424,141 (GRCm39) missense probably benign 0.05
R7982:Or51f5 UTSW 7 102,424,310 (GRCm39) missense probably damaging 1.00
R8025:Or51f5 UTSW 7 102,424,463 (GRCm39) missense probably benign 0.34
R8222:Or51f5 UTSW 7 102,424,099 (GRCm39) missense probably damaging 1.00
R8304:Or51f5 UTSW 7 102,423,917 (GRCm39) missense possibly damaging 0.48
R8540:Or51f5 UTSW 7 102,424,339 (GRCm39) missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GGTCTATGCCTTTCAACATTGG -3'
(R):5'- TGCAGTAGAGATGACAATGGCC -3'

Sequencing Primer
(F):5'- GCCTTTCAACATTGGTAACTGTG -3'
(R):5'- CCAAAGGCACTATTGATCCTGGTATC -3'
Posted On 2020-10-20