Incidental Mutation 'R8404:Apcdd1'
ID 652332
Institutional Source Beutler Lab
Gene Symbol Apcdd1
Ensembl Gene ENSMUSG00000071847
Gene Name adenomatosis polyposis coli down-regulated 1
Synonyms Drapc1, EIG180
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock # R8404 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 62922327-62953195 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 62933915 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 33 (R33S)
Ref Sequence ENSEMBL: ENSMUSP00000094302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]
AlphaFold Q3U128
Predicted Effect possibly damaging
Transcript: ENSMUST00000096554
AA Change: R33S

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847
AA Change: R33S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163716
AA Change: R33S

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847
AA Change: R33S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Abca6 T A 11: 110,219,319 L599F probably damaging Het
Accs T C 2: 93,838,115 Y337C probably damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Brsk1 T C 7: 4,706,696 S441P probably damaging Het
Crlf2 T C 5: 109,557,051 D98G probably benign Het
Dnah10 A G 5: 124,773,542 D1693G probably damaging Het
Gfm2 T C 13: 97,162,977 I402T probably benign Het
Gm6899 C G 11: 26,593,630 R66G unknown Het
Hira T G 16: 18,952,162 S850A possibly damaging Het
Krt10 C T 11: 99,387,533 E267K probably damaging Het
Lama5 T C 2: 180,195,222 N1074S probably damaging Het
Lrp2 C T 2: 69,514,241 W844* probably null Het
Maml3 T C 3: 51,690,656 Y869C probably damaging Het
Nap1l1 T A 10: 111,481,301 M1K probably null Het
Nbeal2 C T 9: 110,634,389 S1258N possibly damaging Het
Olfr561 T A 7: 102,774,927 Y134* probably null Het
Pam T C 1: 97,895,633 Q271R probably damaging Het
Pced1a T C 2: 130,423,657 probably benign Het
Pdcd11 T C 19: 47,104,792 V503A probably damaging Het
Pinx1 T A 14: 63,919,614 V330D unknown Het
Prdm2 T C 4: 143,135,014 I569V probably damaging Het
Prickle2 T C 6: 92,420,321 D197G probably damaging Het
Prmt8 C T 6: 127,689,862 C383Y possibly damaging Het
Prss42 T C 9: 110,800,916 L246P probably damaging Het
Ptpra C A 2: 130,549,759 D732E probably damaging Het
Rpp30 T C 19: 36,089,203 L112P probably damaging Het
Saraf C T 8: 34,165,448 P227L probably benign Het
Slc22a28 A T 19: 8,131,429 C116* probably null Het
Slc45a2 T C 15: 11,027,872 I509T possibly damaging Het
Spag7 T C 11: 70,669,233 S17G probably benign Het
Trim62 A G 4: 128,909,440 I428V probably benign Het
Urb2 A G 8: 124,025,203 T92A probably damaging Het
Zan A T 5: 137,398,332 C4321S unknown Het
Zbtb32 G A 7: 30,591,610 P87S possibly damaging Het
Zer1 C T 2: 30,105,023 probably null Het
Zfat T C 15: 68,105,067 T1078A probably benign Het
Other mutations in Apcdd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Apcdd1 APN 18 62933865 splice site probably benign
IGL01522:Apcdd1 APN 18 62952115 missense possibly damaging 0.50
IGL01637:Apcdd1 APN 18 62937286 missense probably damaging 1.00
IGL02069:Apcdd1 APN 18 62949983 missense probably damaging 1.00
IGL02183:Apcdd1 APN 18 62951854 missense probably damaging 0.98
IGL02268:Apcdd1 APN 18 62950188 missense probably damaging 0.99
IGL02664:Apcdd1 APN 18 62951820 splice site probably benign
R0207:Apcdd1 UTSW 18 62950079 missense probably benign 0.04
R0363:Apcdd1 UTSW 18 62937097 missense possibly damaging 0.46
R0540:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0567:Apcdd1 UTSW 18 62934036 missense possibly damaging 0.93
R0607:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0629:Apcdd1 UTSW 18 62933970 missense probably damaging 1.00
R1118:Apcdd1 UTSW 18 62952024 missense probably benign
R1178:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1180:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1181:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R4363:Apcdd1 UTSW 18 62951932 missense possibly damaging 0.95
R5534:Apcdd1 UTSW 18 62937034 missense probably benign 0.01
R5622:Apcdd1 UTSW 18 62936902 splice site probably null
R5771:Apcdd1 UTSW 18 62936956 missense probably damaging 1.00
R5852:Apcdd1 UTSW 18 62937063 missense probably damaging 1.00
R5934:Apcdd1 UTSW 18 62951869 missense possibly damaging 0.72
R6109:Apcdd1 UTSW 18 62937366 missense probably damaging 1.00
R6515:Apcdd1 UTSW 18 62951839 missense probably damaging 1.00
R6625:Apcdd1 UTSW 18 62951858 missense probably damaging 1.00
R6831:Apcdd1 UTSW 18 62950126 nonsense probably null
R6931:Apcdd1 UTSW 18 62933908 missense probably damaging 1.00
R7018:Apcdd1 UTSW 18 62937049 missense probably damaging 0.98
R7115:Apcdd1 UTSW 18 62936953 missense probably damaging 1.00
R7148:Apcdd1 UTSW 18 62951845 missense probably damaging 1.00
R7326:Apcdd1 UTSW 18 62952188 nonsense probably null
R8025:Apcdd1 UTSW 18 62936908 missense probably damaging 1.00
R8114:Apcdd1 UTSW 18 62950056 missense probably damaging 1.00
R8261:Apcdd1 UTSW 18 62933903 missense possibly damaging 0.86
R9015:Apcdd1 UTSW 18 62950086 missense possibly damaging 0.93
R9040:Apcdd1 UTSW 18 62937343 missense probably damaging 0.96
R9288:Apcdd1 UTSW 18 62922660 start gained probably benign
R9295:Apcdd1 UTSW 18 62922660 start gained probably benign
R9297:Apcdd1 UTSW 18 62922660 start gained probably benign
R9317:Apcdd1 UTSW 18 62922660 start gained probably benign
R9319:Apcdd1 UTSW 18 62922660 start gained probably benign
R9393:Apcdd1 UTSW 18 62922660 start gained probably benign
R9394:Apcdd1 UTSW 18 62922660 start gained probably benign
R9396:Apcdd1 UTSW 18 62922660 start gained probably benign
R9397:Apcdd1 UTSW 18 62922660 start gained probably benign
X0028:Apcdd1 UTSW 18 62937130 missense possibly damaging 0.59
Z1088:Apcdd1 UTSW 18 62937183 missense probably benign 0.18
Z1177:Apcdd1 UTSW 18 62922691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCTTCAAGAGTGTCCCCGACTC -3'
(R):5'- CTTCCCGTCTCAAATGCAGC -3'

Sequencing Primer
(F):5'- CGACTCTGGCATGGGAGTTC -3'
(R):5'- AAATGCAGCTCTTACCCTGTGG -3'
Posted On 2020-10-20