Incidental Mutation 'R8404:Slc22a28'
ID652333
Institutional Source Beutler Lab
Gene Symbol Slc22a28
Ensembl Gene ENSMUSG00000063590
Gene Namesolute carrier family 22, member 28
SynonymsGm5631
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock #R8404 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location8062209-8131982 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 8131429 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 116 (C116*)
Ref Sequence ENSEMBL: ENSMUSP00000067114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065651]
Predicted Effect probably null
Transcript: ENSMUST00000065651
AA Change: C116*
SMART Domains Protein: ENSMUSP00000067114
Gene: ENSMUSG00000063590
AA Change: C116*

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 527 1.4e-26 PFAM
Pfam:MFS_1 140 375 1.1e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Abca6 T A 11: 110,219,319 L599F probably damaging Het
Accs T C 2: 93,838,115 Y337C probably damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Apcdd1 A T 18: 62,933,915 R33S possibly damaging Het
Brsk1 T C 7: 4,706,696 S441P probably damaging Het
Crlf2 T C 5: 109,557,051 D98G probably benign Het
Dnah10 A G 5: 124,773,542 D1693G probably damaging Het
Gfm2 T C 13: 97,162,977 I402T probably benign Het
Gm6899 C G 11: 26,593,630 R66G unknown Het
Hira T G 16: 18,952,162 S850A possibly damaging Het
Krt10 C T 11: 99,387,533 E267K probably damaging Het
Lama5 T C 2: 180,195,222 N1074S probably damaging Het
Lrp2 C T 2: 69,514,241 W844* probably null Het
Maml3 T C 3: 51,690,656 Y869C probably damaging Het
Nap1l1 T A 10: 111,481,301 M1K probably null Het
Nbeal2 C T 9: 110,634,389 S1258N possibly damaging Het
Olfr561 T A 7: 102,774,927 Y134* probably null Het
Pam T C 1: 97,895,633 Q271R probably damaging Het
Pced1a T C 2: 130,423,657 probably benign Het
Pdcd11 T C 19: 47,104,792 V503A probably damaging Het
Pinx1 T A 14: 63,919,614 V330D unknown Het
Prdm2 T C 4: 143,135,014 I569V probably damaging Het
Prickle2 T C 6: 92,420,321 D197G probably damaging Het
Prmt8 C T 6: 127,689,862 C383Y possibly damaging Het
Prss42 T C 9: 110,800,916 L246P probably damaging Het
Ptpra C A 2: 130,549,759 D732E probably damaging Het
Rpp30 T C 19: 36,089,203 L112P probably damaging Het
Saraf C T 8: 34,165,448 P227L probably benign Het
Slc45a2 T C 15: 11,027,872 I509T possibly damaging Het
Spag7 T C 11: 70,669,233 S17G probably benign Het
Trim62 A G 4: 128,909,440 I428V probably benign Het
Urb2 A G 8: 124,025,203 T92A probably damaging Het
Zan A T 5: 137,398,332 C4321S unknown Het
Zbtb32 G A 7: 30,591,610 P87S possibly damaging Het
Zer1 C T 2: 30,105,023 probably null Het
Zfat T C 15: 68,105,067 T1078A probably benign Het
Other mutations in Slc22a28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Slc22a28 APN 19 8130203 missense possibly damaging 0.89
IGL00515:Slc22a28 APN 19 8117064 missense probably benign 0.34
IGL01025:Slc22a28 APN 19 8116908 splice site probably benign
IGL02697:Slc22a28 APN 19 8117127 missense probably benign 0.06
PIT4378001:Slc22a28 UTSW 19 8071914 missense probably damaging 0.96
R0744:Slc22a28 UTSW 19 8116833 missense possibly damaging 0.94
R0836:Slc22a28 UTSW 19 8116833 missense possibly damaging 0.94
R1398:Slc22a28 UTSW 19 8130202 nonsense probably null
R1456:Slc22a28 UTSW 19 8071858 missense possibly damaging 0.50
R1603:Slc22a28 UTSW 19 8063309 missense probably damaging 1.00
R1993:Slc22a28 UTSW 19 8117124 missense possibly damaging 0.79
R2254:Slc22a28 UTSW 19 8064493 missense probably benign
R2262:Slc22a28 UTSW 19 8071208 missense probably benign 0.00
R4078:Slc22a28 UTSW 19 8101413 missense probably benign 0.15
R4165:Slc22a28 UTSW 19 8063408 missense possibly damaging 0.95
R4612:Slc22a28 UTSW 19 8101406 missense probably damaging 1.00
R4947:Slc22a28 UTSW 19 8131452 missense probably benign 0.03
R5573:Slc22a28 UTSW 19 8071097 missense possibly damaging 0.50
R5611:Slc22a28 UTSW 19 8063333 missense probably damaging 1.00
R5621:Slc22a28 UTSW 19 8071011 missense probably benign 0.00
R5671:Slc22a28 UTSW 19 8131431 missense probably damaging 1.00
R6063:Slc22a28 UTSW 19 8117022 missense probably benign 0.01
R6358:Slc22a28 UTSW 19 8071888 missense probably damaging 0.99
R6385:Slc22a28 UTSW 19 8101480 missense probably damaging 0.99
R6680:Slc22a28 UTSW 19 8101393 missense probably benign 0.07
R6767:Slc22a28 UTSW 19 8117045 missense probably damaging 1.00
R6865:Slc22a28 UTSW 19 8064491 nonsense probably null
R6947:Slc22a28 UTSW 19 8064510 missense possibly damaging 0.58
R7049:Slc22a28 UTSW 19 8071905 missense probably benign
R7269:Slc22a28 UTSW 19 8117127 missense probably benign 0.06
R7484:Slc22a28 UTSW 19 8071127 missense probably benign
R7823:Slc22a28 UTSW 19 8064525 missense probably benign 0.38
R7856:Slc22a28 UTSW 19 8063333 missense probably damaging 1.00
R7980:Slc22a28 UTSW 19 8101473 missense probably damaging 0.99
R8323:Slc22a28 UTSW 19 8131424 missense probably damaging 1.00
R8435:Slc22a28 UTSW 19 8071200 missense probably benign 0.13
R8529:Slc22a28 UTSW 19 8063413 missense probably benign 0.01
Z1088:Slc22a28 UTSW 19 8062398 missense probably damaging 0.96
Z1176:Slc22a28 UTSW 19 8062383 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGTGATAATCTGTGGTCATCC -3'
(R):5'- CTCTGATAATGGCAGTAGGATCC -3'

Sequencing Primer
(F):5'- CTGTGGTCATCCTTAGAATAAAATGC -3'
(R):5'- TAGGATCCTGAGCCAAGATGACC -3'
Posted On2020-10-20