Incidental Mutation 'R8405:Anxa3'
ID 652341
Institutional Source Beutler Lab
Gene Symbol Anxa3
Ensembl Gene ENSMUSG00000029484
Gene Name annexin A3
Synonyms Anx3
MMRRC Submission 067879-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8405 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 96941244-96993827 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 96978295 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 226 (D226E)
Ref Sequence ENSEMBL: ENSMUSP00000031447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031447] [ENSMUST00000198631]
AlphaFold O35639
Predicted Effect probably benign
Transcript: ENSMUST00000031447
AA Change: D226E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000031447
Gene: ENSMUSG00000029484
AA Change: D226E

DomainStartEndE-ValueType
ANX 35 87 5.74e-24 SMART
ANX 107 159 1.67e-25 SMART
ANX 191 243 3.67e-22 SMART
ANX 266 318 2.87e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198631
SMART Domains Protein: ENSMUSP00000143491
Gene: ENSMUSG00000029484

DomainStartEndE-ValueType
ANX 35 87 5.74e-24 SMART
ANX 107 159 1.67e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. This protein functions in the inhibition of phopholipase A2 and cleavage of inositol 1,2-cyclic phosphate to form inositol 1-phosphate. This protein may also play a role in anti-coagulation. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T C 3: 153,635,165 (GRCm39) probably benign Het
Anxa8 T C 14: 33,819,881 (GRCm39) L290P probably damaging Het
Brd4 C A 17: 32,448,505 (GRCm39) K57N unknown Het
Cpne8 T A 15: 90,456,235 (GRCm39) Q176L possibly damaging Het
Csf2rb2 T C 15: 78,172,093 (GRCm39) D439G possibly damaging Het
Csmd3 A G 15: 47,619,379 (GRCm39) S1832P probably damaging Het
Cux1 A G 5: 136,304,241 (GRCm39) S1320P possibly damaging Het
Cyp2t4 A T 7: 26,856,894 (GRCm39) probably null Het
Dnah2 A T 11: 69,349,289 (GRCm39) L2449Q probably damaging Het
Dock1 A G 7: 134,379,192 (GRCm39) M640V probably benign Het
Efcab3 G A 11: 104,612,024 (GRCm39) S622N probably benign Het
Ergic1 T A 17: 26,874,096 (GRCm39) I274N probably damaging Het
Fat3 T C 9: 15,907,167 (GRCm39) D2945G probably damaging Het
Fscb T C 12: 64,520,278 (GRCm39) E396G possibly damaging Het
Gab1 T A 8: 81,501,594 (GRCm39) R581* probably null Het
Gabarapl1 A G 6: 129,514,497 (GRCm39) D45G probably null Het
Gfap C A 11: 102,782,255 (GRCm39) Q418H probably benign Het
Gfap T A 11: 102,782,256 (GRCm39) Q418L probably benign Het
Hectd1 T A 12: 51,874,178 (GRCm39) M33L probably benign Het
Kcnh7 T A 2: 62,533,446 (GRCm39) K1144N probably benign Het
Lrit3 C T 3: 129,582,301 (GRCm39) G562D probably benign Het
Mab21l1 A T 3: 55,690,659 (GRCm39) Q82L probably damaging Het
Naip6 C T 13: 100,436,784 (GRCm39) A580T possibly damaging Het
Nav1 T C 1: 135,382,508 (GRCm39) K1258R unknown Het
Nbas C A 12: 13,329,394 (GRCm39) A113E probably damaging Het
Nlrp1b A T 11: 71,073,356 (GRCm39) D162E possibly damaging Het
Nr2c1 A T 10: 94,031,155 (GRCm39) H572L probably benign Het
Or52s1 A T 7: 102,861,408 (GRCm39) I114F probably benign Het
Or56b2j T A 7: 104,353,208 (GRCm39) S145T probably benign Het
Pcdha12 T A 18: 37,154,250 (GRCm39) V323E possibly damaging Het
Pgm5 T A 19: 24,705,106 (GRCm39) H469L probably benign Het
Phf8-ps C A 17: 33,286,038 (GRCm39) A255S probably benign Het
Pja2 T C 17: 64,616,505 (GRCm39) E130G possibly damaging Het
Ppp2r2b G C 18: 42,778,805 (GRCm39) D443E probably benign Het
Prdm9 T A 17: 15,764,456 (GRCm39) T775S probably benign Het
Rbm6 A G 9: 107,730,016 (GRCm39) S211P probably benign Het
Rgl2 C T 17: 34,152,698 (GRCm39) Q408* probably null Het
Rgs14 C T 13: 55,530,962 (GRCm39) R389W probably damaging Het
Rtcb T C 10: 85,793,534 (GRCm39) D13G probably benign Het
Slc23a4 C T 6: 34,923,145 (GRCm39) C280Y probably benign Het
Slc7a5 G T 8: 122,613,661 (GRCm39) T297K possibly damaging Het
Spef2 A G 15: 9,612,643 (GRCm39) V1229A probably benign Het
Stag3 A C 5: 138,302,914 (GRCm39) T1064P probably damaging Het
Tnnt1 A G 7: 4,510,592 (GRCm39) S211P probably damaging Het
Trim26 A G 17: 37,167,095 (GRCm39) D262G possibly damaging Het
Trim30a A T 7: 104,060,749 (GRCm39) Y342* probably null Het
Trpm7 T C 2: 126,658,755 (GRCm39) I1134V probably benign Het
Tsc22d1 G A 14: 76,655,734 (GRCm39) G738S probably damaging Het
Usp39 A G 6: 72,305,521 (GRCm39) F421L probably damaging Het
Vmn2r97 G A 17: 19,134,802 (GRCm39) probably null Het
Zfat T C 15: 68,018,410 (GRCm39) Y968C probably damaging Het
Other mutations in Anxa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01984:Anxa3 APN 5 96,982,630 (GRCm39) splice site probably benign
IGL03243:Anxa3 APN 5 96,976,551 (GRCm39) unclassified probably benign
F6893:Anxa3 UTSW 5 96,972,853 (GRCm39) unclassified probably benign
R0026:Anxa3 UTSW 5 96,986,260 (GRCm39) missense probably benign 0.01
R0468:Anxa3 UTSW 5 96,958,958 (GRCm39) missense probably benign 0.00
R0562:Anxa3 UTSW 5 96,960,743 (GRCm39) missense possibly damaging 0.90
R0724:Anxa3 UTSW 5 96,976,607 (GRCm39) missense possibly damaging 0.70
R1442:Anxa3 UTSW 5 96,976,549 (GRCm39) splice site probably null
R2276:Anxa3 UTSW 5 96,978,349 (GRCm39) critical splice donor site probably null
R4922:Anxa3 UTSW 5 96,968,288 (GRCm39) missense probably damaging 1.00
R5108:Anxa3 UTSW 5 96,978,273 (GRCm39) missense possibly damaging 0.83
R5230:Anxa3 UTSW 5 96,986,171 (GRCm39) missense possibly damaging 0.47
R5529:Anxa3 UTSW 5 96,976,238 (GRCm39) missense probably benign 0.00
R5733:Anxa3 UTSW 5 96,968,331 (GRCm39) missense probably damaging 1.00
R5857:Anxa3 UTSW 5 96,976,651 (GRCm39) critical splice donor site probably null
R5902:Anxa3 UTSW 5 96,960,712 (GRCm39) nonsense probably null
R6558:Anxa3 UTSW 5 96,960,798 (GRCm39) splice site probably null
R6772:Anxa3 UTSW 5 96,958,972 (GRCm39) missense probably damaging 0.98
R7425:Anxa3 UTSW 5 96,982,680 (GRCm39) missense probably benign 0.30
R7515:Anxa3 UTSW 5 96,986,179 (GRCm39) missense probably damaging 1.00
R7619:Anxa3 UTSW 5 96,978,263 (GRCm39) missense probably damaging 1.00
R8018:Anxa3 UTSW 5 96,968,288 (GRCm39) missense probably damaging 1.00
R8197:Anxa3 UTSW 5 96,982,651 (GRCm39) missense probably benign 0.05
R8723:Anxa3 UTSW 5 96,986,206 (GRCm39) missense probably benign 0.05
R9046:Anxa3 UTSW 5 96,976,626 (GRCm39) missense probably damaging 0.99
R9119:Anxa3 UTSW 5 96,976,557 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CTGCTTCAGACTGGAGAGAG -3'
(R):5'- GCCATGTAGGATGCTGTAGG -3'

Sequencing Primer
(F):5'- GAAATGGCCTAAGGAGTTCAGTCTTC -3'
(R):5'- CTGTAGGAGCAGAGATGGATTAGTCC -3'
Posted On 2020-10-20