Incidental Mutation 'R0311:Gdpd3'
ID65238
Institutional Source Beutler Lab
Gene Symbol Gdpd3
Ensembl Gene ENSMUSG00000030703
Gene Nameglycerophosphodiester phosphodiesterase domain containing 3
Synonyms1110015E22Rik
MMRRC Submission 038521-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0311 (G1)
Quality Score113
Status Validated
Chromosome7
Chromosomal Location126766334-126775649 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 126767189 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 66 (R66Q)
Ref Sequence ENSEMBL: ENSMUSP00000032944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032944] [ENSMUST00000050201] [ENSMUST00000057669] [ENSMUST00000091328]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032944
AA Change: R66Q

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032944
Gene: ENSMUSG00000030703
AA Change: R66Q

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
Pfam:GDPD 44 202 1.1e-23 PFAM
low complexity region 208 216 N/A INTRINSIC
low complexity region 311 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050201
SMART Domains Protein: ENSMUSP00000101969
Gene: ENSMUSG00000063065

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
S_TKc 43 331 3.3e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057669
SMART Domains Protein: ENSMUSP00000051619
Gene: ENSMUSG00000063065

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
S_TKc 43 331 3.3e-97 SMART
Blast:S_TKc 335 372 1e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000091328
SMART Domains Protein: ENSMUSP00000088880
Gene: ENSMUSG00000063065

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 213 2.5e-24 PFAM
Pfam:Pkinase 1 216 2.2e-58 PFAM
Pfam:APH 17 108 7.6e-7 PFAM
Blast:S_TKc 220 257 4e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205468
Predicted Effect probably benign
Transcript: ENSMUST00000205657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205910
Predicted Effect probably benign
Transcript: ENSMUST00000206272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207004
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A C 7: 120,402,904 M1547L probably damaging Het
Abcb4 A G 5: 8,934,243 K658E probably benign Het
Abr A G 11: 76,509,127 S15P possibly damaging Het
Adgrb2 G C 4: 130,017,129 A1168P probably damaging Het
Adgre4 A T 17: 55,802,010 E339V probably benign Het
Asprv1 T C 6: 86,628,840 W223R probably damaging Het
Ccdc89 A G 7: 90,426,693 E37G probably damaging Het
Cd48 C A 1: 171,699,580 Y191* probably null Het
Chd4 T C 6: 125,101,665 I257T probably benign Het
Clca4b T C 3: 144,932,496 M2V probably benign Het
Dnah11 A T 12: 118,127,133 D1025E probably benign Het
Erich5 A G 15: 34,472,939 *363W probably null Het
Etl4 A G 2: 20,807,129 D1341G probably damaging Het
Fbxw11 A G 11: 32,722,083 T184A probably benign Het
Fktn A G 4: 53,744,620 Q300R probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Hexb A G 13: 97,183,819 probably benign Het
Kdm4b A G 17: 56,386,200 R346G probably benign Het
Mbtd1 T A 11: 93,921,357 probably null Het
Med23 T A 10: 24,897,358 C653S possibly damaging Het
Nwd2 A T 5: 63,804,998 I642L probably damaging Het
Olfr1444 A G 19: 12,861,869 I31M probably benign Het
Olfr1448 T A 19: 12,920,096 Y71F possibly damaging Het
Olfr912 T C 9: 38,539,297 V134A probably benign Het
Pbld2 T C 10: 63,054,507 probably null Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plpp2 C T 10: 79,527,580 R77K probably damaging Het
Pym1 G T 10: 128,765,984 R168L possibly damaging Het
Rbm4 T C 19: 4,787,556 Y300C probably damaging Het
Rnf207 A G 4: 152,315,779 C175R probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Speg T C 1: 75,430,937 V3196A probably damaging Het
Syne1 T A 10: 5,348,943 I1048L possibly damaging Het
Th T C 7: 142,896,041 E41G probably damaging Het
Tmx4 T A 2: 134,598,526 *336L probably null Het
Tnfrsf18 T C 4: 156,026,415 V10A possibly damaging Het
Tnxb A T 17: 34,716,984 I2670F probably damaging Het
Tpx2 T C 2: 152,890,492 V562A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Vps18 T C 2: 119,297,365 Y890H probably benign Het
Ythdc1 G A 5: 86,835,705 D670N probably damaging Het
Other mutations in Gdpd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Gdpd3 APN 7 126767426 nonsense probably null
IGL01113:Gdpd3 APN 7 126767825 missense probably benign 0.01
IGL01433:Gdpd3 APN 7 126771184 missense possibly damaging 0.82
IGL01465:Gdpd3 APN 7 126768657 missense possibly damaging 0.63
IGL01736:Gdpd3 APN 7 126766523 missense probably damaging 0.99
PIT4431001:Gdpd3 UTSW 7 126766475 missense probably benign 0.05
R0118:Gdpd3 UTSW 7 126770993 missense probably damaging 1.00
R2049:Gdpd3 UTSW 7 126768594 missense probably damaging 0.99
R4976:Gdpd3 UTSW 7 126767282 missense probably damaging 1.00
R6151:Gdpd3 UTSW 7 126775502 missense probably benign 0.00
R6170:Gdpd3 UTSW 7 126771164 missense probably benign 0.04
R6898:Gdpd3 UTSW 7 126771029 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGTCCAAGCCCCATCAAGTTCC -3'
(R):5'- GCGTGAAAGTGATGCAGCTCTCAG -3'

Sequencing Primer
(F):5'- CCCATCAAGTTCCATGTGAGG -3'
(R):5'- CAGCTCTCAGTGTGAGGGG -3'
Posted On2013-08-08