Incidental Mutation 'R8405:Rgl2'
ID 652381
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Name ral guanine nucleotide dissociation stimulator-like 2
Synonyms KE1.5, Rab2l, Rgt2, Rlf
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock # R8405 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 33929543-33937687 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 33933724 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 408 (Q408*)
Ref Sequence ENSEMBL: ENSMUSP00000041082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]
AlphaFold Q61193
PDB Structure STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025161
SMART Domains Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 127 152 N/A INTRINSIC
IG 168 292 3.45e0 SMART
IG_like 302 406 4.78e1 SMART
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000047503
AA Change: Q408*
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: Q408*

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173284
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Acadm T C 3: 153,929,528 probably benign Het
Anxa3 C A 5: 96,830,436 D226E probably benign Het
Anxa8 T C 14: 34,097,924 L290P probably damaging Het
Brd4 C A 17: 32,229,531 K57N unknown Het
Cpne8 T A 15: 90,572,032 Q176L possibly damaging Het
Csf2rb2 T C 15: 78,287,893 D439G possibly damaging Het
Csmd3 A G 15: 47,755,983 S1832P probably damaging Het
Cux1 A G 5: 136,275,387 S1320P possibly damaging Het
Cyp2t4 A T 7: 27,157,469 probably null Het
Dnah2 A T 11: 69,458,463 L2449Q probably damaging Het
Dock1 A G 7: 134,777,463 M640V probably benign Het
Ergic1 T A 17: 26,655,122 I274N probably damaging Het
Fat3 T C 9: 15,995,871 D2945G probably damaging Het
Fscb T C 12: 64,473,504 E396G possibly damaging Het
Gab1 T A 8: 80,774,965 R581* probably null Het
Gabarapl1 A G 6: 129,537,534 D45G probably null Het
Gfap C A 11: 102,891,429 Q418H probably benign Het
Gfap T A 11: 102,891,430 Q418L probably benign Het
Gm11639 G A 11: 104,721,198 S622N probably benign Het
Hectd1 T A 12: 51,827,395 M33L probably benign Het
Kcnh7 T A 2: 62,703,102 K1144N probably benign Het
Lrit3 C T 3: 129,788,652 G562D probably benign Het
Mab21l1 A T 3: 55,783,238 Q82L probably damaging Het
Naip6 C T 13: 100,300,276 A580T possibly damaging Het
Nav1 T C 1: 135,454,770 K1258R unknown Het
Nbas C A 12: 13,279,393 A113E probably damaging Het
Nlrp1b A T 11: 71,182,530 D162E possibly damaging Het
Nr2c1 A T 10: 94,195,293 H572L probably benign Het
Olfr593 A T 7: 103,212,201 I114F probably benign Het
Olfr663 T A 7: 104,704,001 S145T probably benign Het
Pcdha12 T A 18: 37,021,197 V323E possibly damaging Het
Pgm5 T A 19: 24,727,742 H469L probably benign Het
Pja2 T C 17: 64,309,510 E130G possibly damaging Het
Ppp2r2b G C 18: 42,645,740 D443E probably benign Het
Prdm9 T A 17: 15,544,194 T775S probably benign Het
Rbm6 A G 9: 107,852,817 S211P probably benign Het
Rgs14 C T 13: 55,383,149 R389W probably damaging Het
Rtcb T C 10: 85,957,670 D13G probably benign Het
Slc23a4 C T 6: 34,946,210 C280Y probably benign Het
Slc7a5 G T 8: 121,886,922 T297K possibly damaging Het
Spef2 A G 15: 9,612,557 V1229A probably benign Het
Stag3 A C 5: 138,304,652 T1064P probably damaging Het
Tnnt1 A G 7: 4,507,593 S211P probably damaging Het
Trim26 A G 17: 36,856,203 D262G possibly damaging Het
Trim30a A T 7: 104,411,542 Y342* probably null Het
Trpm7 T C 2: 126,816,835 I1134V probably benign Het
Tsc22d1 G A 14: 76,418,294 G738S probably damaging Het
Usp39 A G 6: 72,328,538 F421L probably damaging Het
Vmn2r97 G A 17: 18,914,540 probably null Het
Zfat T C 15: 68,146,561 Y968C probably damaging Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 33933136 missense probably benign 0.31
IGL00898:Rgl2 APN 17 33933418 missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 33935936 missense probably benign 0.00
IGL00985:Rgl2 APN 17 33932101 missense probably damaging 1.00
IGL02140:Rgl2 APN 17 33933124 missense probably damaging 1.00
IGL02214:Rgl2 APN 17 33935189 missense probably benign 0.06
IGL02486:Rgl2 APN 17 33935980 missense probably damaging 0.97
IGL02579:Rgl2 APN 17 33937160 missense probably benign 0.08
IGL02976:Rgl2 APN 17 33933962 missense possibly damaging 0.95
Hypotenuse UTSW 17 33931739 missense probably benign 0.00
Pedernales UTSW 17 33932038 critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 33933940 missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 33932738 missense probably damaging 1.00
R0456:Rgl2 UTSW 17 33936849 splice site probably null
R0825:Rgl2 UTSW 17 33935159 splice site probably null
R1742:Rgl2 UTSW 17 33937223 splice site probably null
R1777:Rgl2 UTSW 17 33931744 missense probably benign 0.00
R1829:Rgl2 UTSW 17 33933621 missense probably benign 0.00
R1908:Rgl2 UTSW 17 33932148 missense probably benign 0.00
R1961:Rgl2 UTSW 17 33933615 missense probably damaging 1.00
R2102:Rgl2 UTSW 17 33933340 splice site probably null
R3001:Rgl2 UTSW 17 33932605 missense probably benign 0.00
R3002:Rgl2 UTSW 17 33932605 missense probably benign 0.00
R3755:Rgl2 UTSW 17 33932597 missense probably benign 0.01
R3756:Rgl2 UTSW 17 33932597 missense probably benign 0.01
R3978:Rgl2 UTSW 17 33935162 missense probably benign 0.02
R4042:Rgl2 UTSW 17 33937262 missense probably damaging 1.00
R4064:Rgl2 UTSW 17 33937108 missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 33936932 missense probably benign 0.04
R4661:Rgl2 UTSW 17 33933226 missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 33937173 missense probably benign 0.00
R4922:Rgl2 UTSW 17 33932775 unclassified probably benign
R5119:Rgl2 UTSW 17 33937120 missense probably benign 0.00
R5167:Rgl2 UTSW 17 33935974 nonsense probably null
R5279:Rgl2 UTSW 17 33935948 missense probably benign
R5319:Rgl2 UTSW 17 33933555 missense probably benign 0.02
R5337:Rgl2 UTSW 17 33934984 missense probably damaging 0.99
R5881:Rgl2 UTSW 17 33932717 missense probably benign 0.01
R5945:Rgl2 UTSW 17 33932038 critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 33931765 missense probably benign 0.01
R6358:Rgl2 UTSW 17 33937131 splice site probably null
R6867:Rgl2 UTSW 17 33932687 missense probably benign 0.09
R7174:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7203:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7250:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7253:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7455:Rgl2 UTSW 17 33932683 missense probably benign 0.32
R7513:Rgl2 UTSW 17 33932555 missense probably benign
R7752:Rgl2 UTSW 17 33935825 missense possibly damaging 0.82
R7901:Rgl2 UTSW 17 33935825 missense possibly damaging 0.82
R7941:Rgl2 UTSW 17 33931739 missense probably benign 0.00
R8158:Rgl2 UTSW 17 33936944 missense probably benign 0.27
R8209:Rgl2 UTSW 17 33932527 missense possibly damaging 0.91
R8226:Rgl2 UTSW 17 33932527 missense possibly damaging 0.91
R8871:Rgl2 UTSW 17 33935000 missense probably damaging 1.00
R9205:Rgl2 UTSW 17 33936028 missense probably damaging 1.00
R9591:Rgl2 UTSW 17 33932477 missense possibly damaging 0.50
X0028:Rgl2 UTSW 17 33932458 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTTCTTCCTCTCTAGGGACAGC -3'
(R):5'- AGCATCACGAGGTCCTTCAG -3'

Sequencing Primer
(F):5'- GGGACAGCCTCCGAGTCTTTTC -3'
(R):5'- GGAACCACACCCTGCAGG -3'
Posted On 2020-10-20