Mutagenetix > Incidental Mutation

Incidental Mutation 'R8405:Rgl2'

652381

Institutional Source

Beutler Lab

Gene Symbol

Rgl2

Ensembl Gene

ENSMUSG00000041354

Gene Name

ral guanine nucleotide dissociation stimulator-like 2

Synonyms

KE1.5, Rab2l, Rgt2, Rlf

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.104) question?

Stock #

R8405 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

33929543-33937687 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 33933724 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 408 (Q408*)

Ref Sequence

ENSEMBL: ENSMUSP00000041082 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]

AlphaFold

Q61193

PDB Structure

STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000025161

SMART Domains

Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	48	65	N/A	INTRINSIC
low complexity region	127	152	N/A	INTRINSIC
IG	168	292	3.45e0	SMART
IG_like	302	406	4.78e1	SMART
transmembrane domain	416	438	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000047503
AA Change: Q408*

SMART Domains

Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: Q408*

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	31	42	N/A	INTRINSIC
low complexity region	44	63	N/A	INTRINSIC
RasGEFN	87	212	9.54e-30	SMART
RasGEF	239	514	7.15e-106	SMART
low complexity region	578	592	N/A	INTRINSIC
low complexity region	602	619	N/A	INTRINSIC
low complexity region	633	648	N/A	INTRINSIC
RA	649	736	2.05e-19	SMART
low complexity region	737	762	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173284

SMART Domains

Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

Domain	Start	End	E-Value	Type
Blast:RasGEF	2	67	1e-35	BLAST
PDB:4JGW\|B	2	67	1e-35	PDB
SCOP:d1bkds_	2	94	3e-16	SMART
low complexity region	131	145	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	186	201	N/A	INTRINSIC
RA	202	289	2.05e-19	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

98% (49/50)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	C	A	17: 33,067,064	A255S	probably benign	Het
Acadm	T	C	3: 153,929,528		probably benign	Het
Anxa3	C	A	5: 96,830,436	D226E	probably benign	Het
Anxa8	T	C	14: 34,097,924	L290P	probably damaging	Het
Brd4	C	A	17: 32,229,531	K57N	unknown	Het
Cpne8	T	A	15: 90,572,032	Q176L	possibly damaging	Het
Csf2rb2	T	C	15: 78,287,893	D439G	possibly damaging	Het
Csmd3	A	G	15: 47,755,983	S1832P	probably damaging	Het
Cux1	A	G	5: 136,275,387	S1320P	possibly damaging	Het
Cyp2t4	A	T	7: 27,157,469		probably null	Het
Dnah2	A	T	11: 69,458,463	L2449Q	probably damaging	Het
Dock1	A	G	7: 134,777,463	M640V	probably benign	Het
Ergic1	T	A	17: 26,655,122	I274N	probably damaging	Het
Fat3	T	C	9: 15,995,871	D2945G	probably damaging	Het
Fscb	T	C	12: 64,473,504	E396G	possibly damaging	Het
Gab1	T	A	8: 80,774,965	R581*	probably null	Het
Gabarapl1	A	G	6: 129,537,534	D45G	probably null	Het
Gfap	C	A	11: 102,891,429	Q418H	probably benign	Het
Gfap	T	A	11: 102,891,430	Q418L	probably benign	Het
Gm11639	G	A	11: 104,721,198	S622N	probably benign	Het
Hectd1	T	A	12: 51,827,395	M33L	probably benign	Het
Kcnh7	T	A	2: 62,703,102	K1144N	probably benign	Het
Lrit3	C	T	3: 129,788,652	G562D	probably benign	Het
Mab21l1	A	T	3: 55,783,238	Q82L	probably damaging	Het
Naip6	C	T	13: 100,300,276	A580T	possibly damaging	Het
Nav1	T	C	1: 135,454,770	K1258R	unknown	Het
Nbas	C	A	12: 13,279,393	A113E	probably damaging	Het
Nlrp1b	A	T	11: 71,182,530	D162E	possibly damaging	Het
Nr2c1	A	T	10: 94,195,293	H572L	probably benign	Het
Olfr593	A	T	7: 103,212,201	I114F	probably benign	Het
Olfr663	T	A	7: 104,704,001	S145T	probably benign	Het
Pcdha12	T	A	18: 37,021,197	V323E	possibly damaging	Het
Pgm5	T	A	19: 24,727,742	H469L	probably benign	Het
Pja2	T	C	17: 64,309,510	E130G	possibly damaging	Het
Ppp2r2b	G	C	18: 42,645,740	D443E	probably benign	Het
Prdm9	T	A	17: 15,544,194	T775S	probably benign	Het
Rbm6	A	G	9: 107,852,817	S211P	probably benign	Het
Rgs14	C	T	13: 55,383,149	R389W	probably damaging	Het
Rtcb	T	C	10: 85,957,670	D13G	probably benign	Het
Slc23a4	C	T	6: 34,946,210	C280Y	probably benign	Het
Slc7a5	G	T	8: 121,886,922	T297K	possibly damaging	Het
Spef2	A	G	15: 9,612,557	V1229A	probably benign	Het
Stag3	A	C	5: 138,304,652	T1064P	probably damaging	Het
Tnnt1	A	G	7: 4,507,593	S211P	probably damaging	Het
Trim26	A	G	17: 36,856,203	D262G	possibly damaging	Het
Trim30a	A	T	7: 104,411,542	Y342*	probably null	Het
Trpm7	T	C	2: 126,816,835	I1134V	probably benign	Het
Tsc22d1	G	A	14: 76,418,294	G738S	probably damaging	Het
Usp39	A	G	6: 72,328,538	F421L	probably damaging	Het
Vmn2r97	G	A	17: 18,914,540		probably null	Het
Zfat	T	C	15: 68,146,561	Y968C	probably damaging	Het

Other mutations in Rgl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Rgl2	APN	17	33933136	missense	probably benign	0.31
IGL00898:Rgl2	APN	17	33933418	missense	possibly damaging	0.95
IGL00965:Rgl2	APN	17	33935936	missense	probably benign	0.00
IGL00985:Rgl2	APN	17	33932101	missense	probably damaging	1.00
IGL02140:Rgl2	APN	17	33933124	missense	probably damaging	1.00
IGL02214:Rgl2	APN	17	33935189	missense	probably benign	0.06
IGL02486:Rgl2	APN	17	33935980	missense	probably damaging	0.97
IGL02579:Rgl2	APN	17	33937160	missense	probably benign	0.08
IGL02976:Rgl2	APN	17	33933962	missense	possibly damaging	0.95
Hypotenuse	UTSW	17	33931739	missense	probably benign	0.00
Pedernales	UTSW	17	33932038	critical splice acceptor site	probably null
PIT4354001:Rgl2	UTSW	17	33933940	missense	possibly damaging	0.80
R0347:Rgl2	UTSW	17	33932738	missense	probably damaging	1.00
R0456:Rgl2	UTSW	17	33936849	splice site	probably null
R0825:Rgl2	UTSW	17	33935159	splice site	probably null
R1742:Rgl2	UTSW	17	33937223	splice site	probably null
R1777:Rgl2	UTSW	17	33931744	missense	probably benign	0.00
R1829:Rgl2	UTSW	17	33933621	missense	probably benign	0.00
R1908:Rgl2	UTSW	17	33932148	missense	probably benign	0.00
R1961:Rgl2	UTSW	17	33933615	missense	probably damaging	1.00
R2102:Rgl2	UTSW	17	33933340	splice site	probably null
R3001:Rgl2	UTSW	17	33932605	missense	probably benign	0.00
R3002:Rgl2	UTSW	17	33932605	missense	probably benign	0.00
R3755:Rgl2	UTSW	17	33932597	missense	probably benign	0.01
R3756:Rgl2	UTSW	17	33932597	missense	probably benign	0.01
R3978:Rgl2	UTSW	17	33935162	missense	probably benign	0.02
R4042:Rgl2	UTSW	17	33937262	missense	probably damaging	1.00
R4064:Rgl2	UTSW	17	33937108	missense	possibly damaging	0.77
R4204:Rgl2	UTSW	17	33936932	missense	probably benign	0.04
R4661:Rgl2	UTSW	17	33933226	missense	possibly damaging	0.77
R4852:Rgl2	UTSW	17	33937173	missense	probably benign	0.00
R4922:Rgl2	UTSW	17	33932775	unclassified	probably benign
R5119:Rgl2	UTSW	17	33937120	missense	probably benign	0.00
R5167:Rgl2	UTSW	17	33935974	nonsense	probably null
R5279:Rgl2	UTSW	17	33935948	missense	probably benign
R5319:Rgl2	UTSW	17	33933555	missense	probably benign	0.02
R5337:Rgl2	UTSW	17	33934984	missense	probably damaging	0.99
R5881:Rgl2	UTSW	17	33932717	missense	probably benign	0.01
R5945:Rgl2	UTSW	17	33932038	critical splice acceptor site	probably null
R6165:Rgl2	UTSW	17	33931765	missense	probably benign	0.01
R6358:Rgl2	UTSW	17	33937131	splice site	probably null
R6867:Rgl2	UTSW	17	33932687	missense	probably benign	0.09
R7174:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7182:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7183:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7184:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7196:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7203:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7250:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7253:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7254:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7255:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7256:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7282:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7455:Rgl2	UTSW	17	33932683	missense	probably benign	0.32
R7513:Rgl2	UTSW	17	33932555	missense	probably benign
R7752:Rgl2	UTSW	17	33935825	missense	possibly damaging	0.82
R7901:Rgl2	UTSW	17	33935825	missense	possibly damaging	0.82
R7941:Rgl2	UTSW	17	33931739	missense	probably benign	0.00
R8158:Rgl2	UTSW	17	33936944	missense	probably benign	0.27
R8209:Rgl2	UTSW	17	33932527	missense	possibly damaging	0.91
R8226:Rgl2	UTSW	17	33932527	missense	possibly damaging	0.91
R8871:Rgl2	UTSW	17	33935000	missense	probably damaging	1.00
R9205:Rgl2	UTSW	17	33936028	missense	probably damaging	1.00
R9591:Rgl2	UTSW	17	33932477	missense	possibly damaging	0.50
X0028:Rgl2	UTSW	17	33932458	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- GTTCTTCCTCTCTAGGGACAGC -3'
(R):5'- AGCATCACGAGGTCCTTCAG -3'

Sequencing Primer
(F):5'- GGGACAGCCTCCGAGTCTTTTC -3'
(R):5'- GGAACCACACCCTGCAGG -3'

Posted On

2020-10-20