Incidental Mutation 'R8405:Ppp2r2b'
ID652385
Institutional Source Beutler Lab
Gene Symbol Ppp2r2b
Ensembl Gene ENSMUSG00000024500
Gene Nameprotein phosphatase 2, regulatory subunit B, beta
SynonymsSCA12, 6330404L05Rik, 2900026H06Rik, E130009M08Rik, PR55-BETA, PP2A-PR55B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8405 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location42637432-43059471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 42645740 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 443 (D443E)
Ref Sequence ENSEMBL: ENSMUSP00000025377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025377] [ENSMUST00000117687] [ENSMUST00000120632]
Predicted Effect probably benign
Transcript: ENSMUST00000025377
AA Change: D443E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025377
Gene: ENSMUSG00000024500
AA Change: D443E

DomainStartEndE-ValueType
WD40 14 55 6.42e-1 SMART
WD40 82 122 3.7e0 SMART
WD40 164 203 1.66e0 SMART
WD40 214 254 1.38e1 SMART
WD40 273 311 5.7e1 SMART
Blast:WD40 315 369 6e-26 BLAST
WD40 405 442 1.33e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117687
AA Change: D440E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113731
Gene: ENSMUSG00000024500
AA Change: D440E

DomainStartEndE-ValueType
WD40 13 52 1.92e0 SMART
WD40 79 119 3.7e0 SMART
WD40 161 200 1.66e0 SMART
WD40 211 251 1.38e1 SMART
WD40 270 308 5.7e1 SMART
Blast:WD40 312 366 4e-26 BLAST
WD40 402 439 1.33e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120632
AA Change: D440E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113411
Gene: ENSMUSG00000024500
AA Change: D440E

DomainStartEndE-ValueType
WD40 13 52 1.92e0 SMART
WD40 79 119 3.7e0 SMART
WD40 161 200 1.66e0 SMART
WD40 211 251 1.38e1 SMART
WD40 270 308 5.7e1 SMART
Blast:WD40 312 366 4e-26 BLAST
WD40 402 439 1.33e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a beta isoform of the regulatory subunit B55 subfamily. Defects in this gene cause autosomal dominant spinocerebellar ataxia 12 (SCA12), a disease caused by degeneration of the cerebellum, sometimes involving the brainstem and spinal cord, and in resulting in poor coordination of speech and body movements. Multiple alternatively spliced variants, which encode different isoforms, have been identified for this gene. The 5' UTR of some of these variants includes a CAG trinucleotide repeat sequence (7-28 copies) that can be expanded to 55-78 copies in cases of SCA12. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Acadm T C 3: 153,929,528 probably benign Het
Anxa3 C A 5: 96,830,436 D226E probably benign Het
Anxa8 T C 14: 34,097,924 L290P probably damaging Het
Brd4 C A 17: 32,229,531 K57N unknown Het
Cpne8 T A 15: 90,572,032 Q176L possibly damaging Het
Csf2rb2 T C 15: 78,287,893 D439G possibly damaging Het
Csmd3 A G 15: 47,755,983 S1832P probably damaging Het
Cux1 A G 5: 136,275,387 S1320P possibly damaging Het
Cyp2t4 A T 7: 27,157,469 probably null Het
Dnah2 A T 11: 69,458,463 L2449Q probably damaging Het
Dock1 A G 7: 134,777,463 M640V probably benign Het
Ergic1 T A 17: 26,655,122 I274N probably damaging Het
Fat3 T C 9: 15,995,871 D2945G probably damaging Het
Fscb T C 12: 64,473,504 E396G possibly damaging Het
Gab1 T A 8: 80,774,965 R581* probably null Het
Gabarapl1 A G 6: 129,537,534 D45G probably null Het
Gfap C A 11: 102,891,429 Q418H probably benign Het
Gfap T A 11: 102,891,430 Q418L probably benign Het
Gm11639 G A 11: 104,721,198 S622N probably benign Het
Hectd1 T A 12: 51,827,395 M33L probably benign Het
Kcnh7 T A 2: 62,703,102 K1144N probably benign Het
Lrit3 C T 3: 129,788,652 G562D probably benign Het
Mab21l1 A T 3: 55,783,238 Q82L probably damaging Het
Naip6 C T 13: 100,300,276 A580T possibly damaging Het
Nav1 T C 1: 135,454,770 K1258R unknown Het
Nbas C A 12: 13,279,393 A113E probably damaging Het
Nlrp1b A T 11: 71,182,530 D162E possibly damaging Het
Nr2c1 A T 10: 94,195,293 H572L probably benign Het
Olfr593 A T 7: 103,212,201 I114F probably benign Het
Olfr663 T A 7: 104,704,001 S145T probably benign Het
Pcdha12 T A 18: 37,021,197 V323E possibly damaging Het
Pgm5 T A 19: 24,727,742 H469L probably benign Het
Pja2 T C 17: 64,309,510 E130G possibly damaging Het
Prdm9 T A 17: 15,544,194 T775S probably benign Het
Rbm6 A G 9: 107,852,817 S211P probably benign Het
Rgl2 C T 17: 33,933,724 Q408* probably null Het
Rgs14 C T 13: 55,383,149 R389W probably damaging Het
Rtcb T C 10: 85,957,670 D13G probably benign Het
Slc23a4 C T 6: 34,946,210 C280Y probably benign Het
Slc7a5 G T 8: 121,886,922 T297K possibly damaging Het
Spef2 A G 15: 9,612,557 V1229A probably benign Het
Stag3 A C 5: 138,304,652 T1064P probably damaging Het
Tnnt1 A G 7: 4,507,593 S211P probably damaging Het
Trim26 A G 17: 36,856,203 D262G possibly damaging Het
Trim30a A T 7: 104,411,542 Y342* probably null Het
Trpm7 T C 2: 126,816,835 I1134V probably benign Het
Tsc22d1 G A 14: 76,418,294 G738S probably damaging Het
Usp39 A G 6: 72,328,538 F421L probably damaging Het
Vmn2r97 G A 17: 18,914,540 probably null Het
Zfat T C 15: 68,146,561 Y968C probably damaging Het
Other mutations in Ppp2r2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Ppp2r2b APN 18 42645775 missense probably damaging 0.99
IGL01999:Ppp2r2b APN 18 42645723 utr 3 prime probably benign
IGL02610:Ppp2r2b APN 18 42648775 splice site probably benign
IGL02733:Ppp2r2b APN 18 42648728 missense possibly damaging 0.96
IGL02899:Ppp2r2b APN 18 42645809 missense probably damaging 1.00
Degradation UTSW 18 42688338 missense probably benign 0.27
R0737:Ppp2r2b UTSW 18 43059192 missense probably benign
R1459:Ppp2r2b UTSW 18 42737990 missense probably damaging 1.00
R1616:Ppp2r2b UTSW 18 42688310 missense probably benign 0.32
R1635:Ppp2r2b UTSW 18 43059210 missense probably benign 0.01
R3435:Ppp2r2b UTSW 18 42741109 missense possibly damaging 0.48
R4204:Ppp2r2b UTSW 18 42738050 missense probably benign
R4301:Ppp2r2b UTSW 18 42898746 missense probably null
R5062:Ppp2r2b UTSW 18 42688461 missense possibly damaging 0.48
R5147:Ppp2r2b UTSW 18 42645877 missense probably benign 0.00
R5207:Ppp2r2b UTSW 18 42688352 missense probably damaging 1.00
R5277:Ppp2r2b UTSW 18 42741142 missense probably damaging 1.00
R6004:Ppp2r2b UTSW 18 43059159 splice site probably null
R6528:Ppp2r2b UTSW 18 42688338 missense probably benign 0.27
R6735:Ppp2r2b UTSW 18 42688588 splice site probably null
R7521:Ppp2r2b UTSW 18 43059177 missense probably benign
R7831:Ppp2r2b UTSW 18 42701532 missense probably benign
R8486:Ppp2r2b UTSW 18 42898804 missense probably benign 0.17
Z1177:Ppp2r2b UTSW 18 42648693 missense probably benign 0.04
Z1177:Ppp2r2b UTSW 18 42688423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTACCGAGTTTGACAGACG -3'
(R):5'- TTGAGGCCTCAAGGGAAAAC -3'

Sequencing Primer
(F):5'- ACCGAGTTTGACAGACGTCTCTTAG -3'
(R):5'- CAGCAAACCCCGGGCTATC -3'
Posted On2020-10-20