Incidental Mutation 'R8406:Atg9a'
ID 652387
Institutional Source Beutler Lab
Gene Symbol Atg9a
Ensembl Gene ENSMUSG00000033124
Gene Name autophagy related 9A
Synonyms Apg9l1
MMRRC Submission 067765-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8406 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 75157509-75168654 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 75167028 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 8 (Y8D)
Ref Sequence ENSEMBL: ENSMUSP00000047449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040689] [ENSMUST00000127625] [ENSMUST00000145459] [ENSMUST00000152233] [ENSMUST00000186744] [ENSMUST00000188347] [ENSMUST00000189665] [ENSMUST00000189702]
AlphaFold Q68FE2
Predicted Effect probably damaging
Transcript: ENSMUST00000040689
AA Change: Y8D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047449
Gene: ENSMUSG00000033124
AA Change: Y8D

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 173 530 3.4e-134 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127625
SMART Domains Protein: ENSMUSP00000137179
Gene: ENSMUSG00000026199

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
Blast:ZnF_C2H2 96 120 1e-10 BLAST
low complexity region 143 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145459
SMART Domains Protein: ENSMUSP00000135971
Gene: ENSMUSG00000026199

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
Blast:ZnF_C2H2 96 120 1e-9 BLAST
low complexity region 143 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152233
SMART Domains Protein: ENSMUSP00000136163
Gene: ENSMUSG00000026199

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
Blast:ZnF_C2H2 96 120 6e-11 BLAST
low complexity region 143 171 N/A INTRINSIC
low complexity region 394 407 N/A INTRINSIC
low complexity region 425 451 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
Blast:ANK 515 545 2e-9 BLAST
ANK 556 585 6.81e-3 SMART
coiled coil region 628 681 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186744
AA Change: Y8D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000187785
Predicted Effect probably damaging
Transcript: ENSMUST00000188347
AA Change: Y8D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139731
Gene: ENSMUSG00000033124
AA Change: Y8D

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189665
AA Change: Y8D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140012
Gene: ENSMUSG00000033124
AA Change: Y8D

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189702
AA Change: Y8D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139641
Gene: ENSMUSG00000033124
AA Change: Y8D

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189820
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation all die within 1 day of birth and display impaired autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 109,977,343 (GRCm39) F139L probably damaging Het
Adgrg6 A T 10: 14,343,082 (GRCm39) D288E probably benign Het
Agbl1 A G 7: 76,068,415 (GRCm39) E327G Het
Aipl1 T A 11: 71,922,332 (GRCm39) M126L possibly damaging Het
Alkal2 G T 12: 30,934,850 (GRCm39) G23V probably damaging Het
Arl3 A T 19: 46,530,823 (GRCm39) S157T probably benign Het
Armc3 A T 2: 19,240,365 (GRCm39) I41F probably damaging Het
Atp10b T G 11: 43,093,984 (GRCm39) H509Q probably benign Het
Cabyr C A 18: 12,883,804 (GRCm39) T97K probably benign Het
Ccdc91 T C 6: 147,438,920 (GRCm39) F174S possibly damaging Het
Cep350 A T 1: 155,798,164 (GRCm39) H1207Q probably benign Het
Clstn3 A T 6: 124,439,136 (GRCm39) N40K probably damaging Het
Col4a4 G A 1: 82,501,611 (GRCm39) P381S unknown Het
Cpne5 A T 17: 29,428,455 (GRCm39) F116Y probably benign Het
Csf2rb2 T C 15: 78,171,216 (GRCm39) T457A probably benign Het
Cyb5d2 T C 11: 72,679,959 (GRCm39) E112G probably benign Het
Cyp2b13 T C 7: 25,781,223 (GRCm39) F212L probably benign Het
Dlx6 T G 6: 6,863,779 (GRCm39) S134A probably benign Het
Egln1 A G 8: 125,638,489 (GRCm39) Y380H probably benign Het
Fbxl13 A T 5: 21,728,652 (GRCm39) I479N probably damaging Het
Fhip1a G T 3: 85,580,027 (GRCm39) P726Q probably benign Het
Fis1 A G 5: 136,991,865 (GRCm39) K20E probably benign Het
Foxk1 G T 5: 142,387,528 (GRCm39) V84L unknown Het
Gdf5 C A 2: 155,784,272 (GRCm39) G227W probably damaging Het
Ghrh T A 2: 157,175,656 (GRCm39) T13S probably benign Het
Gnb2 A G 5: 137,526,865 (GRCm39) L308P probably damaging Het
Grik2 A T 10: 49,148,863 (GRCm39) V574D probably damaging Het
Hydin A T 8: 111,336,543 (GRCm39) I5107F possibly damaging Het
Kl A T 5: 150,906,229 (GRCm39) Y533F probably benign Het
Man2b1 G T 8: 85,822,907 (GRCm39) R816L probably damaging Het
Myo5c T C 9: 75,182,823 (GRCm39) Y821H probably damaging Het
Myo7b A T 18: 32,092,866 (GRCm39) C2076S probably damaging Het
Naip6 C T 13: 100,436,784 (GRCm39) A580T possibly damaging Het
Nectin2 A T 7: 19,472,275 (GRCm39) V38E probably damaging Het
Or13a24 A T 7: 140,154,044 (GRCm39) probably benign Het
Osbpl9 T C 4: 108,921,770 (GRCm39) Y536C possibly damaging Het
Pcdh18 T G 3: 49,710,998 (GRCm39) I106L probably damaging Het
Pde4dip T C 3: 97,606,428 (GRCm39) K2149E probably benign Het
Pds5a A T 5: 65,803,681 (GRCm39) C588S probably benign Het
Phf8-ps C A 17: 33,286,038 (GRCm39) A255S probably benign Het
Pop1 T C 15: 34,529,316 (GRCm39) M812T probably benign Het
Pou2f3 T C 9: 43,051,153 (GRCm39) T178A probably damaging Het
Rab44 C T 17: 29,359,294 (GRCm39) A494V unknown Het
Ros1 G C 10: 51,977,941 (GRCm39) T1456S possibly damaging Het
Rubcnl T G 14: 75,289,425 (GRCm39) F644L probably damaging Het
Saraf C T 8: 34,632,602 (GRCm39) P227L probably benign Het
Sh3glb1 T G 3: 144,397,198 (GRCm39) E383D probably damaging Het
Sh3rf3 T C 10: 58,919,407 (GRCm39) V508A probably damaging Het
Sirt6 A T 10: 81,458,328 (GRCm39) H308Q probably benign Het
Slc29a1 T A 17: 45,900,706 (GRCm39) I119F probably damaging Het
Smtnl1 C T 2: 84,648,742 (GRCm39) E171K probably benign Het
Spg11 T A 2: 121,923,923 (GRCm39) E799D probably damaging Het
Tecpr1 A T 5: 144,137,658 (GRCm39) W894R probably damaging Het
Tiam2 A C 17: 3,558,065 (GRCm39) I1230L possibly damaging Het
Tnfrsf8 A G 4: 145,019,265 (GRCm39) L190P probably damaging Het
Trim35 C T 14: 66,534,724 (GRCm39) T69M possibly damaging Het
Ttll7 T C 3: 146,645,779 (GRCm39) Y546H probably benign Het
Ubash3b C T 9: 40,940,971 (GRCm39) G389R probably damaging Het
Vma21-ps C T 4: 52,497,034 (GRCm39) V71I probably damaging Het
Vmn1r43 T A 6: 89,847,414 (GRCm39) H24L possibly damaging Het
Vps37c T A 19: 10,687,719 (GRCm39) L60Q probably damaging Het
Ythdf2 A G 4: 131,931,946 (GRCm39) W405R probably damaging Het
Zfp775 T C 6: 48,597,637 (GRCm39) C504R probably damaging Het
Zfp82 A G 7: 29,761,652 (GRCm39) probably null Het
Zpr1 T A 9: 46,185,400 (GRCm39) I127N probably damaging Het
Other mutations in Atg9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Atg9a APN 1 75,167,010 (GRCm39) missense probably damaging 1.00
IGL02041:Atg9a APN 1 75,159,748 (GRCm39) missense possibly damaging 0.47
IGL03367:Atg9a APN 1 75,164,601 (GRCm39) missense probably benign 0.18
PIT4494001:Atg9a UTSW 1 75,164,597 (GRCm39) nonsense probably null
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0408:Atg9a UTSW 1 75,161,939 (GRCm39) missense probably damaging 1.00
R0520:Atg9a UTSW 1 75,163,178 (GRCm39) nonsense probably null
R0653:Atg9a UTSW 1 75,166,972 (GRCm39) missense probably damaging 0.96
R0666:Atg9a UTSW 1 75,161,734 (GRCm39) missense probably damaging 0.99
R0961:Atg9a UTSW 1 75,163,390 (GRCm39) missense probably damaging 0.99
R1489:Atg9a UTSW 1 75,162,734 (GRCm39) missense probably damaging 1.00
R1490:Atg9a UTSW 1 75,162,389 (GRCm39) missense possibly damaging 0.70
R1692:Atg9a UTSW 1 75,166,999 (GRCm39) missense probably benign 0.04
R1997:Atg9a UTSW 1 75,166,270 (GRCm39) missense probably benign 0.33
R2005:Atg9a UTSW 1 75,162,635 (GRCm39) missense probably benign 0.18
R2172:Atg9a UTSW 1 75,162,329 (GRCm39) missense probably damaging 0.99
R4004:Atg9a UTSW 1 75,163,095 (GRCm39) missense probably damaging 1.00
R4105:Atg9a UTSW 1 75,162,603 (GRCm39) missense probably damaging 1.00
R5010:Atg9a UTSW 1 75,162,704 (GRCm39) splice site probably null
R5220:Atg9a UTSW 1 75,162,372 (GRCm39) missense probably damaging 1.00
R5898:Atg9a UTSW 1 75,162,916 (GRCm39) missense probably damaging 1.00
R6295:Atg9a UTSW 1 75,161,702 (GRCm39) missense probably benign 0.01
R6390:Atg9a UTSW 1 75,164,625 (GRCm39) missense probably damaging 1.00
R7312:Atg9a UTSW 1 75,164,736 (GRCm39) missense probably damaging 1.00
R7729:Atg9a UTSW 1 75,161,204 (GRCm39) missense probably benign 0.34
R8111:Atg9a UTSW 1 75,164,366 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,163,009 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,161,927 (GRCm39) missense probably damaging 1.00
R8256:Atg9a UTSW 1 75,163,563 (GRCm39) missense possibly damaging 0.88
R8319:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8321:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8382:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8482:Atg9a UTSW 1 75,162,870 (GRCm39) missense probably damaging 0.99
R8855:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R8866:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R9381:Atg9a UTSW 1 75,162,726 (GRCm39) missense probably benign
R9441:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9442:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9448:Atg9a UTSW 1 75,162,849 (GRCm39) missense probably benign 0.35
R9608:Atg9a UTSW 1 75,161,739 (GRCm39) missense possibly damaging 0.52
R9703:Atg9a UTSW 1 75,162,431 (GRCm39) missense probably damaging 0.98
RF021:Atg9a UTSW 1 75,159,273 (GRCm39) missense probably damaging 0.96
Z1176:Atg9a UTSW 1 75,163,203 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAAGTGGCTATTCTCCCC -3'
(R):5'- CCAAGCTTAGCTGTGCTTCTTG -3'

Sequencing Primer
(F):5'- CTAGCTGTCATGTCCCAA -3'
(R):5'- ATCCCTGTACTGCTTCTGAGTCAAG -3'
Posted On 2020-10-20