Incidental Mutation 'R8406:Pcdh18'
ID652395
Institutional Source Beutler Lab
Gene Symbol Pcdh18
Ensembl Gene ENSMUSG00000037892
Gene Nameprotocadherin 18
SynonymsPCDH68L
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8406 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location49743296-49757325 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 49756549 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 106 (I106L)
Ref Sequence ENSEMBL: ENSMUSP00000039245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035931] [ENSMUST00000191794]
Predicted Effect probably damaging
Transcript: ENSMUST00000035931
AA Change: I106L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039245
Gene: ENSMUSG00000037892
AA Change: I106L

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
CA 51 135 1.36e-1 SMART
CA 159 244 3.78e-20 SMART
CA 268 352 1.12e-22 SMART
CA 382 463 5.76e-25 SMART
CA 487 574 2.51e-25 SMART
CA 603 684 8e-3 SMART
transmembrane domain 698 720 N/A INTRINSIC
low complexity region 772 783 N/A INTRINSIC
low complexity region 988 1009 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191794
AA Change: I106L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141995
Gene: ENSMUSG00000037892
AA Change: I106L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 51 135 6.6e-4 SMART
CA 159 244 1.9e-22 SMART
CA 268 352 5.6e-25 SMART
CA 382 463 2.7e-27 SMART
CA 487 574 1.2e-27 SMART
CA 603 684 3.9e-5 SMART
transmembrane domain 698 720 N/A INTRINSIC
low complexity region 772 783 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194603
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. Although its specific function is undetermined, the cadherin-related neuronal receptor is thought to play a role in the establishment and function of specific cell-cell connections in the brain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Abca8a A G 11: 110,086,517 F139L probably damaging Het
Adgrg6 A T 10: 14,467,338 D288E probably benign Het
Agbl1 A G 7: 76,418,667 E327G Het
Aipl1 T A 11: 72,031,506 M126L possibly damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Arl3 A T 19: 46,542,384 S157T probably benign Het
Armc3 A T 2: 19,235,554 I41F probably damaging Het
Atg9a A C 1: 75,190,384 Y8D probably damaging Het
Atp10b T G 11: 43,203,157 H509Q probably benign Het
Cabyr C A 18: 12,750,747 T97K probably benign Het
Ccdc91 T C 6: 147,537,422 F174S possibly damaging Het
Cep350 A T 1: 155,922,418 H1207Q probably benign Het
Clstn3 A T 6: 124,462,177 N40K probably damaging Het
Col4a4 G A 1: 82,523,890 P381S unknown Het
Cpne5 A T 17: 29,209,481 F116Y probably benign Het
Csf2rb2 T C 15: 78,287,016 T457A probably benign Het
Cyb5d2 T C 11: 72,789,133 E112G probably benign Het
Cyp2b13 T C 7: 26,081,798 F212L probably benign Het
Dlx6 T G 6: 6,863,779 S134A probably benign Het
Egln1 A G 8: 124,911,750 Y380H probably benign Het
Fam160a1 G T 3: 85,672,720 P726Q probably benign Het
Fbxl13 A T 5: 21,523,654 I479N probably damaging Het
Fis1 A G 5: 136,963,011 K20E probably benign Het
Foxk1 G T 5: 142,401,773 V84L unknown Het
Gdf5 C A 2: 155,942,352 G227W probably damaging Het
Ghrh T A 2: 157,333,736 T13S probably benign Het
Gnb2 A G 5: 137,528,603 L308P probably damaging Het
Grik2 A T 10: 49,272,767 V574D probably damaging Het
Hydin A T 8: 110,609,911 I5107F possibly damaging Het
Kl A T 5: 150,982,764 Y533F probably benign Het
Man2b1 G T 8: 85,096,278 R816L probably damaging Het
Myo5c T C 9: 75,275,541 Y821H probably damaging Het
Myo7b A T 18: 31,959,813 C2076S probably damaging Het
Naip6 C T 13: 100,300,276 A580T possibly damaging Het
Nectin2 A T 7: 19,738,350 V38E probably damaging Het
Olfr538 A T 7: 140,574,131 probably benign Het
Osbpl9 T C 4: 109,064,573 Y536C possibly damaging Het
Pde4dip T C 3: 97,699,112 K2149E probably benign Het
Pds5a A T 5: 65,646,338 C588S probably benign Het
Pop1 T C 15: 34,529,170 M812T probably benign Het
Pou2f3 T C 9: 43,139,858 T178A probably damaging Het
Rab44 C T 17: 29,140,320 A494V unknown Het
Ros1 G C 10: 52,101,845 T1456S possibly damaging Het
Rubcnl T G 14: 75,051,985 F644L probably damaging Het
Saraf C T 8: 34,165,448 P227L probably benign Het
Sh3glb1 T G 3: 144,691,437 E383D probably damaging Het
Sh3rf3 T C 10: 59,083,585 V508A probably damaging Het
Sirt6 A T 10: 81,622,494 H308Q probably benign Het
Slc29a1 T A 17: 45,589,780 I119F probably damaging Het
Smtnl1 C T 2: 84,818,398 E171K probably benign Het
Spg11 T A 2: 122,093,442 E799D probably damaging Het
Tecpr1 A T 5: 144,200,840 W894R probably damaging Het
Tiam2 A C 17: 3,507,790 I1230L possibly damaging Het
Tnfrsf8 A G 4: 145,292,695 L190P probably damaging Het
Trim35 C T 14: 66,297,275 T69M possibly damaging Het
Ttll7 T C 3: 146,940,024 Y546H probably benign Het
Ubash3b C T 9: 41,029,675 G389R probably damaging Het
Vma21-ps C T 4: 52,497,034 V71I probably damaging Het
Vmn1r43 T A 6: 89,870,432 H24L possibly damaging Het
Vps37c T A 19: 10,710,355 L60Q probably damaging Het
Ythdf2 A G 4: 132,204,635 W405R probably damaging Het
Zfp775 T C 6: 48,620,703 C504R probably damaging Het
Zfp82 A G 7: 30,062,227 probably null Het
Zpr1 T A 9: 46,274,102 I127N probably damaging Het
Other mutations in Pcdh18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Pcdh18 APN 3 49753379 missense probably damaging 1.00
IGL00639:Pcdh18 APN 3 49755616 missense probably benign 0.34
IGL00954:Pcdh18 APN 3 49756389 missense probably damaging 1.00
IGL01338:Pcdh18 APN 3 49756141 missense probably damaging 1.00
IGL01339:Pcdh18 APN 3 49755798 missense probably benign 0.35
IGL01687:Pcdh18 APN 3 49753533 splice site probably benign
IGL01727:Pcdh18 APN 3 49755700 missense probably damaging 0.99
IGL01788:Pcdh18 APN 3 49755922 nonsense probably null
IGL01824:Pcdh18 APN 3 49754774 missense probably damaging 1.00
IGL01834:Pcdh18 APN 3 49756830 missense probably benign 0.03
IGL01913:Pcdh18 APN 3 49755249 missense possibly damaging 0.94
IGL01915:Pcdh18 APN 3 49744921 missense probably benign
IGL02095:Pcdh18 APN 3 49756156 missense probably benign 0.01
IGL02128:Pcdh18 APN 3 49756686 missense possibly damaging 0.65
IGL02302:Pcdh18 APN 3 49755938 missense probably benign
IGL02342:Pcdh18 APN 3 49756044 missense probably damaging 1.00
IGL02440:Pcdh18 APN 3 49744603 utr 3 prime probably benign
IGL02499:Pcdh18 APN 3 49753447 missense probably benign 0.15
IGL02570:Pcdh18 APN 3 49756625 missense probably benign 0.02
IGL02745:Pcdh18 APN 3 49755891 missense probably damaging 1.00
IGL03073:Pcdh18 APN 3 49753367 missense possibly damaging 0.93
PIT4469001:Pcdh18 UTSW 3 49755069 missense probably benign
R0078:Pcdh18 UTSW 3 49756344 missense probably damaging 1.00
R0196:Pcdh18 UTSW 3 49756698 splice site probably null
R0524:Pcdh18 UTSW 3 49755642 missense probably damaging 0.98
R0661:Pcdh18 UTSW 3 49753318 missense possibly damaging 0.64
R0900:Pcdh18 UTSW 3 49756803 missense probably benign 0.25
R1101:Pcdh18 UTSW 3 49753379 missense probably damaging 1.00
R1463:Pcdh18 UTSW 3 49755405 missense probably damaging 0.99
R1778:Pcdh18 UTSW 3 49755634 missense probably benign 0.19
R1850:Pcdh18 UTSW 3 49756405 missense probably benign 0.22
R1875:Pcdh18 UTSW 3 49754705 missense probably damaging 0.99
R1903:Pcdh18 UTSW 3 49755447 missense probably benign
R1956:Pcdh18 UTSW 3 49755951 missense probably benign
R2044:Pcdh18 UTSW 3 49754940 missense probably benign
R2303:Pcdh18 UTSW 3 49755274 missense probably damaging 1.00
R3732:Pcdh18 UTSW 3 49754791 missense probably benign
R3732:Pcdh18 UTSW 3 49754791 missense probably benign
R3733:Pcdh18 UTSW 3 49754791 missense probably benign
R3973:Pcdh18 UTSW 3 49754586 missense probably damaging 1.00
R4281:Pcdh18 UTSW 3 49756533 missense possibly damaging 0.76
R4601:Pcdh18 UTSW 3 49744725 missense probably damaging 1.00
R4631:Pcdh18 UTSW 3 49756441 missense probably damaging 0.99
R4752:Pcdh18 UTSW 3 49755114 missense probably damaging 1.00
R4840:Pcdh18 UTSW 3 49744668 missense probably damaging 0.98
R4867:Pcdh18 UTSW 3 49754664 missense probably damaging 1.00
R5007:Pcdh18 UTSW 3 49754457 missense probably benign 0.23
R5039:Pcdh18 UTSW 3 49754856 missense probably benign
R5169:Pcdh18 UTSW 3 49755966 missense possibly damaging 0.65
R5438:Pcdh18 UTSW 3 49756016 nonsense probably null
R5579:Pcdh18 UTSW 3 49744977 missense probably damaging 1.00
R6000:Pcdh18 UTSW 3 49754464 missense probably damaging 0.99
R6220:Pcdh18 UTSW 3 49745251 missense probably damaging 1.00
R6737:Pcdh18 UTSW 3 49755895 missense probably damaging 0.98
R6789:Pcdh18 UTSW 3 49755915 missense probably benign 0.00
R7011:Pcdh18 UTSW 3 49754782 missense probably benign
R7146:Pcdh18 UTSW 3 49755822 missense probably damaging 1.00
R7150:Pcdh18 UTSW 3 49754694 missense probably benign 0.31
R7205:Pcdh18 UTSW 3 49755474 missense probably benign
R7326:Pcdh18 UTSW 3 49756860 missense probably benign
R7413:Pcdh18 UTSW 3 49744783 missense possibly damaging 0.94
R7755:Pcdh18 UTSW 3 49754829 missense possibly damaging 0.59
R7848:Pcdh18 UTSW 3 49755997 missense possibly damaging 0.54
R8169:Pcdh18 UTSW 3 49745235 missense probably damaging 1.00
R8264:Pcdh18 UTSW 3 49756581 missense probably damaging 1.00
R8352:Pcdh18 UTSW 3 49745175 missense possibly damaging 0.81
R8452:Pcdh18 UTSW 3 49745175 missense possibly damaging 0.81
R8489:Pcdh18 UTSW 3 49754589 missense probably damaging 1.00
R8526:Pcdh18 UTSW 3 49755574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATCTGGGTCGAACGCAC -3'
(R):5'- CCTGGCTAAGAATCTGAAATACAG -3'

Sequencing Primer
(F):5'- TCGAACGCACTGTCCAGG -3'
(R):5'- CGGATCGGTAATTGCTAGACTATCAG -3'
Posted On2020-10-20