Incidental Mutation 'R8406:Tecpr1'
ID 652409
Institutional Source Beutler Lab
Gene Symbol Tecpr1
Ensembl Gene ENSMUSG00000066621
Gene Name tectonin beta-propeller repeat containing 1
Synonyms 2210010N04Rik
MMRRC Submission 067765-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8406 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 144131260-144160433 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 144137658 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 894 (W894R)
Ref Sequence ENSEMBL: ENSMUSP00000082844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085701]
AlphaFold Q80VP0
Predicted Effect probably damaging
Transcript: ENSMUST00000085701
AA Change: W894R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: W894R

DomainStartEndE-ValueType
TECPR 23 59 8.98e1 SMART
DysFN 64 125 6.72e-24 SMART
DysFC 137 170 1.89e-9 SMART
TECPR 192 225 1.79e-1 SMART
TECPR 234 270 2.5e-9 SMART
TECPR 279 317 4.99e-9 SMART
TECPR 326 361 2.42e-7 SMART
low complexity region 381 394 N/A INTRINSIC
PH 614 724 1.69e-2 SMART
TECPR 711 750 1.88e-4 SMART
TECPR 766 800 3.27e-4 SMART
DysFN 821 882 2.95e-20 SMART
DysFC 893 926 1.66e-14 SMART
TECPR 940 974 1.69e1 SMART
TECPR 983 1019 1.45e-5 SMART
TECPR 1028 1065 1.51e-8 SMART
TECPR 1074 1109 1.59e-2 SMART
low complexity region 1125 1137 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 109,977,343 (GRCm39) F139L probably damaging Het
Adgrg6 A T 10: 14,343,082 (GRCm39) D288E probably benign Het
Agbl1 A G 7: 76,068,415 (GRCm39) E327G Het
Aipl1 T A 11: 71,922,332 (GRCm39) M126L possibly damaging Het
Alkal2 G T 12: 30,934,850 (GRCm39) G23V probably damaging Het
Arl3 A T 19: 46,530,823 (GRCm39) S157T probably benign Het
Armc3 A T 2: 19,240,365 (GRCm39) I41F probably damaging Het
Atg9a A C 1: 75,167,028 (GRCm39) Y8D probably damaging Het
Atp10b T G 11: 43,093,984 (GRCm39) H509Q probably benign Het
Cabyr C A 18: 12,883,804 (GRCm39) T97K probably benign Het
Ccdc91 T C 6: 147,438,920 (GRCm39) F174S possibly damaging Het
Cep350 A T 1: 155,798,164 (GRCm39) H1207Q probably benign Het
Clstn3 A T 6: 124,439,136 (GRCm39) N40K probably damaging Het
Col4a4 G A 1: 82,501,611 (GRCm39) P381S unknown Het
Cpne5 A T 17: 29,428,455 (GRCm39) F116Y probably benign Het
Csf2rb2 T C 15: 78,171,216 (GRCm39) T457A probably benign Het
Cyb5d2 T C 11: 72,679,959 (GRCm39) E112G probably benign Het
Cyp2b13 T C 7: 25,781,223 (GRCm39) F212L probably benign Het
Dlx6 T G 6: 6,863,779 (GRCm39) S134A probably benign Het
Egln1 A G 8: 125,638,489 (GRCm39) Y380H probably benign Het
Fbxl13 A T 5: 21,728,652 (GRCm39) I479N probably damaging Het
Fhip1a G T 3: 85,580,027 (GRCm39) P726Q probably benign Het
Fis1 A G 5: 136,991,865 (GRCm39) K20E probably benign Het
Foxk1 G T 5: 142,387,528 (GRCm39) V84L unknown Het
Gdf5 C A 2: 155,784,272 (GRCm39) G227W probably damaging Het
Ghrh T A 2: 157,175,656 (GRCm39) T13S probably benign Het
Gnb2 A G 5: 137,526,865 (GRCm39) L308P probably damaging Het
Grik2 A T 10: 49,148,863 (GRCm39) V574D probably damaging Het
Hydin A T 8: 111,336,543 (GRCm39) I5107F possibly damaging Het
Kl A T 5: 150,906,229 (GRCm39) Y533F probably benign Het
Man2b1 G T 8: 85,822,907 (GRCm39) R816L probably damaging Het
Myo5c T C 9: 75,182,823 (GRCm39) Y821H probably damaging Het
Myo7b A T 18: 32,092,866 (GRCm39) C2076S probably damaging Het
Naip6 C T 13: 100,436,784 (GRCm39) A580T possibly damaging Het
Nectin2 A T 7: 19,472,275 (GRCm39) V38E probably damaging Het
Or13a24 A T 7: 140,154,044 (GRCm39) probably benign Het
Osbpl9 T C 4: 108,921,770 (GRCm39) Y536C possibly damaging Het
Pcdh18 T G 3: 49,710,998 (GRCm39) I106L probably damaging Het
Pde4dip T C 3: 97,606,428 (GRCm39) K2149E probably benign Het
Pds5a A T 5: 65,803,681 (GRCm39) C588S probably benign Het
Phf8-ps C A 17: 33,286,038 (GRCm39) A255S probably benign Het
Pop1 T C 15: 34,529,316 (GRCm39) M812T probably benign Het
Pou2f3 T C 9: 43,051,153 (GRCm39) T178A probably damaging Het
Rab44 C T 17: 29,359,294 (GRCm39) A494V unknown Het
Ros1 G C 10: 51,977,941 (GRCm39) T1456S possibly damaging Het
Rubcnl T G 14: 75,289,425 (GRCm39) F644L probably damaging Het
Saraf C T 8: 34,632,602 (GRCm39) P227L probably benign Het
Sh3glb1 T G 3: 144,397,198 (GRCm39) E383D probably damaging Het
Sh3rf3 T C 10: 58,919,407 (GRCm39) V508A probably damaging Het
Sirt6 A T 10: 81,458,328 (GRCm39) H308Q probably benign Het
Slc29a1 T A 17: 45,900,706 (GRCm39) I119F probably damaging Het
Smtnl1 C T 2: 84,648,742 (GRCm39) E171K probably benign Het
Spg11 T A 2: 121,923,923 (GRCm39) E799D probably damaging Het
Tiam2 A C 17: 3,558,065 (GRCm39) I1230L possibly damaging Het
Tnfrsf8 A G 4: 145,019,265 (GRCm39) L190P probably damaging Het
Trim35 C T 14: 66,534,724 (GRCm39) T69M possibly damaging Het
Ttll7 T C 3: 146,645,779 (GRCm39) Y546H probably benign Het
Ubash3b C T 9: 40,940,971 (GRCm39) G389R probably damaging Het
Vma21-ps C T 4: 52,497,034 (GRCm39) V71I probably damaging Het
Vmn1r43 T A 6: 89,847,414 (GRCm39) H24L possibly damaging Het
Vps37c T A 19: 10,687,719 (GRCm39) L60Q probably damaging Het
Ythdf2 A G 4: 131,931,946 (GRCm39) W405R probably damaging Het
Zfp775 T C 6: 48,597,637 (GRCm39) C504R probably damaging Het
Zfp82 A G 7: 29,761,652 (GRCm39) probably null Het
Zpr1 T A 9: 46,185,400 (GRCm39) I127N probably damaging Het
Other mutations in Tecpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Tecpr1 APN 5 144,145,411 (GRCm39) critical splice donor site probably null
IGL01774:Tecpr1 APN 5 144,148,358 (GRCm39) missense probably damaging 0.97
IGL01960:Tecpr1 APN 5 144,153,737 (GRCm39) missense probably benign 0.00
IGL01973:Tecpr1 APN 5 144,134,806 (GRCm39) splice site probably benign
IGL02244:Tecpr1 APN 5 144,146,821 (GRCm39) missense probably benign
IGL02247:Tecpr1 APN 5 144,143,372 (GRCm39) missense possibly damaging 0.64
IGL02423:Tecpr1 APN 5 144,140,305 (GRCm39) missense possibly damaging 0.88
IGL02679:Tecpr1 APN 5 144,143,364 (GRCm39) missense probably benign 0.28
larghissimo UTSW 5 144,154,075 (GRCm39) missense probably damaging 1.00
PIT4531001:Tecpr1 UTSW 5 144,150,885 (GRCm39) missense probably damaging 0.96
R0121:Tecpr1 UTSW 5 144,147,017 (GRCm39) missense probably benign 0.02
R0125:Tecpr1 UTSW 5 144,134,717 (GRCm39) missense probably damaging 1.00
R0194:Tecpr1 UTSW 5 144,155,335 (GRCm39) missense probably damaging 1.00
R0376:Tecpr1 UTSW 5 144,144,294 (GRCm39) missense possibly damaging 0.94
R0441:Tecpr1 UTSW 5 144,132,759 (GRCm39) missense probably benign
R0504:Tecpr1 UTSW 5 144,150,899 (GRCm39) missense probably damaging 0.99
R0538:Tecpr1 UTSW 5 144,143,092 (GRCm39) missense probably damaging 0.99
R0586:Tecpr1 UTSW 5 144,154,219 (GRCm39) missense probably damaging 1.00
R0607:Tecpr1 UTSW 5 144,149,408 (GRCm39) missense probably damaging 1.00
R0608:Tecpr1 UTSW 5 144,148,317 (GRCm39) missense probably damaging 1.00
R0656:Tecpr1 UTSW 5 144,150,871 (GRCm39) splice site probably null
R0835:Tecpr1 UTSW 5 144,149,410 (GRCm39) missense possibly damaging 0.81
R1080:Tecpr1 UTSW 5 144,153,747 (GRCm39) missense probably damaging 1.00
R1394:Tecpr1 UTSW 5 144,143,357 (GRCm39) missense possibly damaging 0.77
R1597:Tecpr1 UTSW 5 144,151,128 (GRCm39) missense probably benign 0.00
R1663:Tecpr1 UTSW 5 144,134,762 (GRCm39) missense probably benign 0.17
R1785:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R1786:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R1833:Tecpr1 UTSW 5 144,145,426 (GRCm39) missense probably damaging 0.99
R1883:Tecpr1 UTSW 5 144,143,347 (GRCm39) missense probably benign 0.03
R1988:Tecpr1 UTSW 5 144,141,515 (GRCm39) missense possibly damaging 0.94
R2130:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2131:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2132:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2133:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2172:Tecpr1 UTSW 5 144,148,274 (GRCm39) missense probably benign 0.10
R2172:Tecpr1 UTSW 5 144,133,235 (GRCm39) missense probably damaging 1.00
R2290:Tecpr1 UTSW 5 144,150,881 (GRCm39) missense probably damaging 0.99
R3691:Tecpr1 UTSW 5 144,146,797 (GRCm39) missense probably benign 0.10
R4027:Tecpr1 UTSW 5 144,143,077 (GRCm39) missense probably benign 0.41
R4587:Tecpr1 UTSW 5 144,149,408 (GRCm39) missense probably damaging 0.96
R4684:Tecpr1 UTSW 5 144,144,255 (GRCm39) missense probably benign 0.16
R4864:Tecpr1 UTSW 5 144,150,935 (GRCm39) missense probably benign 0.00
R4932:Tecpr1 UTSW 5 144,141,476 (GRCm39) missense probably damaging 0.97
R4955:Tecpr1 UTSW 5 144,154,075 (GRCm39) missense probably damaging 1.00
R5043:Tecpr1 UTSW 5 144,134,672 (GRCm39) splice site probably null
R5459:Tecpr1 UTSW 5 144,144,234 (GRCm39) missense probably damaging 1.00
R5579:Tecpr1 UTSW 5 144,151,162 (GRCm39) missense possibly damaging 0.55
R5677:Tecpr1 UTSW 5 144,155,451 (GRCm39) nonsense probably null
R5679:Tecpr1 UTSW 5 144,144,241 (GRCm39) missense possibly damaging 0.69
R5802:Tecpr1 UTSW 5 144,143,364 (GRCm39) missense probably benign 0.28
R6000:Tecpr1 UTSW 5 144,148,239 (GRCm39) missense probably benign 0.02
R6022:Tecpr1 UTSW 5 144,136,009 (GRCm39) missense possibly damaging 0.95
R6114:Tecpr1 UTSW 5 144,141,458 (GRCm39) missense possibly damaging 0.81
R6251:Tecpr1 UTSW 5 144,135,394 (GRCm39) missense probably damaging 0.97
R6372:Tecpr1 UTSW 5 144,153,776 (GRCm39) missense probably damaging 1.00
R6493:Tecpr1 UTSW 5 144,146,792 (GRCm39) missense probably benign
R7276:Tecpr1 UTSW 5 144,153,838 (GRCm39) nonsense probably null
R7314:Tecpr1 UTSW 5 144,154,150 (GRCm39) missense probably damaging 1.00
R7375:Tecpr1 UTSW 5 144,145,417 (GRCm39) missense possibly damaging 0.68
R7632:Tecpr1 UTSW 5 144,155,544 (GRCm39) missense probably benign 0.03
R7702:Tecpr1 UTSW 5 144,140,236 (GRCm39) missense probably damaging 1.00
R8135:Tecpr1 UTSW 5 144,135,420 (GRCm39) missense probably damaging 0.99
R8844:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8856:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8857:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8866:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8903:Tecpr1 UTSW 5 144,150,845 (GRCm39) intron probably benign
R8926:Tecpr1 UTSW 5 144,153,780 (GRCm39) missense probably damaging 1.00
R9218:Tecpr1 UTSW 5 144,154,049 (GRCm39) missense possibly damaging 0.70
R9423:Tecpr1 UTSW 5 144,155,396 (GRCm39) missense probably damaging 0.98
RF001:Tecpr1 UTSW 5 144,154,204 (GRCm39) missense probably damaging 0.99
Z1176:Tecpr1 UTSW 5 144,155,409 (GRCm39) missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AAGAATAATTTCCCTCCTGCTGC -3'
(R):5'- CAAGAATGTACCAAGGCCGG -3'

Sequencing Primer
(F):5'- TGCTGCCCTTCCCATCG -3'
(R):5'- CATCGCTGCAGTGGACTTG -3'
Posted On 2020-10-20