Incidental Mutation 'R8406:Kl'
ID652410
Institutional Source Beutler Lab
Gene Symbol Kl
Ensembl Gene ENSMUSG00000058488
Gene Nameklotho
Synonymsalpha-kl
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8406 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location150952607-150993817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 150982764 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 533 (Y533F)
Ref Sequence ENSEMBL: ENSMUSP00000077899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078856]
Predicted Effect probably benign
Transcript: ENSMUST00000078856
AA Change: Y533F

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000077899
Gene: ENSMUSG00000058488
AA Change: Y533F

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 45 56 N/A INTRINSIC
Pfam:Glyco_hydro_1 59 380 4.3e-99 PFAM
Pfam:Glyco_hydro_1 376 508 7.9e-33 PFAM
Pfam:Glyco_hydro_1 517 955 1e-79 PFAM
transmembrane domain 984 1006 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I membrane protein that is related to beta-glucosidases. Reduced production of this protein has been observed in patients with chronic renal failure (CRF), and this may be one of the factors underlying the degenerative processes (e.g., arteriosclerosis, osteoporosis, and skin atrophy) seen in CRF. Also, mutations within this protein have been associated with ageing and bone loss. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have a short lifespan and growth retardation with one allele homeostatic imbalances and soft tissue calcification are also seen. With a second allele abnormal cancellous bone and femur morphology are seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Abca8a A G 11: 110,086,517 F139L probably damaging Het
Adgrg6 A T 10: 14,467,338 D288E probably benign Het
Agbl1 A G 7: 76,418,667 E327G Het
Aipl1 T A 11: 72,031,506 M126L possibly damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Arl3 A T 19: 46,542,384 S157T probably benign Het
Armc3 A T 2: 19,235,554 I41F probably damaging Het
Atg9a A C 1: 75,190,384 Y8D probably damaging Het
Atp10b T G 11: 43,203,157 H509Q probably benign Het
Cabyr C A 18: 12,750,747 T97K probably benign Het
Ccdc91 T C 6: 147,537,422 F174S possibly damaging Het
Cep350 A T 1: 155,922,418 H1207Q probably benign Het
Clstn3 A T 6: 124,462,177 N40K probably damaging Het
Col4a4 G A 1: 82,523,890 P381S unknown Het
Cpne5 A T 17: 29,209,481 F116Y probably benign Het
Csf2rb2 T C 15: 78,287,016 T457A probably benign Het
Cyb5d2 T C 11: 72,789,133 E112G probably benign Het
Cyp2b13 T C 7: 26,081,798 F212L probably benign Het
Dlx6 T G 6: 6,863,779 S134A probably benign Het
Egln1 A G 8: 124,911,750 Y380H probably benign Het
Fam160a1 G T 3: 85,672,720 P726Q probably benign Het
Fbxl13 A T 5: 21,523,654 I479N probably damaging Het
Fis1 A G 5: 136,963,011 K20E probably benign Het
Foxk1 G T 5: 142,401,773 V84L unknown Het
Gdf5 C A 2: 155,942,352 G227W probably damaging Het
Ghrh T A 2: 157,333,736 T13S probably benign Het
Gnb2 A G 5: 137,528,603 L308P probably damaging Het
Grik2 A T 10: 49,272,767 V574D probably damaging Het
Hydin A T 8: 110,609,911 I5107F possibly damaging Het
Man2b1 G T 8: 85,096,278 R816L probably damaging Het
Myo5c T C 9: 75,275,541 Y821H probably damaging Het
Myo7b A T 18: 31,959,813 C2076S probably damaging Het
Naip6 C T 13: 100,300,276 A580T possibly damaging Het
Nectin2 A T 7: 19,738,350 V38E probably damaging Het
Olfr538 A T 7: 140,574,131 probably benign Het
Osbpl9 T C 4: 109,064,573 Y536C possibly damaging Het
Pcdh18 T G 3: 49,756,549 I106L probably damaging Het
Pde4dip T C 3: 97,699,112 K2149E probably benign Het
Pds5a A T 5: 65,646,338 C588S probably benign Het
Pop1 T C 15: 34,529,170 M812T probably benign Het
Pou2f3 T C 9: 43,139,858 T178A probably damaging Het
Rab44 C T 17: 29,140,320 A494V unknown Het
Ros1 G C 10: 52,101,845 T1456S possibly damaging Het
Rubcnl T G 14: 75,051,985 F644L probably damaging Het
Saraf C T 8: 34,165,448 P227L probably benign Het
Sh3glb1 T G 3: 144,691,437 E383D probably damaging Het
Sh3rf3 T C 10: 59,083,585 V508A probably damaging Het
Sirt6 A T 10: 81,622,494 H308Q probably benign Het
Slc29a1 T A 17: 45,589,780 I119F probably damaging Het
Smtnl1 C T 2: 84,818,398 E171K probably benign Het
Spg11 T A 2: 122,093,442 E799D probably damaging Het
Tecpr1 A T 5: 144,200,840 W894R probably damaging Het
Tiam2 A C 17: 3,507,790 I1230L possibly damaging Het
Tnfrsf8 A G 4: 145,292,695 L190P probably damaging Het
Trim35 C T 14: 66,297,275 T69M possibly damaging Het
Ttll7 T C 3: 146,940,024 Y546H probably benign Het
Ubash3b C T 9: 41,029,675 G389R probably damaging Het
Vma21-ps C T 4: 52,497,034 V71I probably damaging Het
Vmn1r43 T A 6: 89,870,432 H24L possibly damaging Het
Vps37c T A 19: 10,710,355 L60Q probably damaging Het
Ythdf2 A G 4: 132,204,635 W405R probably damaging Het
Zfp775 T C 6: 48,620,703 C504R probably damaging Het
Zfp82 A G 7: 30,062,227 probably null Het
Zpr1 T A 9: 46,274,102 I127N probably damaging Het
Other mutations in Kl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Kl APN 5 150980768 nonsense probably null
IGL00815:Kl APN 5 150980850 missense possibly damaging 0.55
IGL00840:Kl APN 5 150980787 missense possibly damaging 0.90
IGL01347:Kl APN 5 150980665 missense probably damaging 1.00
IGL01642:Kl APN 5 150980869 missense possibly damaging 0.58
IGL01774:Kl APN 5 150988483 missense probably benign 0.00
IGL01937:Kl APN 5 150988937 missense probably damaging 0.99
IGL01945:Kl APN 5 150988937 missense probably damaging 0.99
IGL02510:Kl APN 5 150989001 missense probably damaging 1.00
IGL02696:Kl APN 5 150980985 missense probably benign 0.01
IGL03028:Kl APN 5 150991550 missense probably damaging 1.00
IGL03149:Kl APN 5 150982735 nonsense probably null
anatolia UTSW 5 150988853 missense possibly damaging 0.69
ararat UTSW 5 150988853 missense possibly damaging 0.69
R6236_kl_940 UTSW 5 150953290 missense probably damaging 1.00
R0480:Kl UTSW 5 150953288 missense probably damaging 1.00
R0565:Kl UTSW 5 150980944 missense possibly damaging 0.76
R0723:Kl UTSW 5 150953101 missense probably damaging 1.00
R1052:Kl UTSW 5 150982520 missense probably damaging 1.00
R1205:Kl UTSW 5 150980688 missense probably damaging 1.00
R1512:Kl UTSW 5 150988597 missense probably benign 0.00
R1529:Kl UTSW 5 150988941 missense probably benign
R1588:Kl UTSW 5 150982632 missense probably benign 0.20
R1714:Kl UTSW 5 150953333 missense probably benign 0.05
R1748:Kl UTSW 5 150980985 missense possibly damaging 0.87
R1885:Kl UTSW 5 150953494 missense possibly damaging 0.67
R1920:Kl UTSW 5 150982667 missense probably benign 0.15
R2156:Kl UTSW 5 150988960 missense probably benign 0.41
R2926:Kl UTSW 5 150953341 missense probably damaging 1.00
R4837:Kl UTSW 5 150980847 missense possibly damaging 0.90
R5221:Kl UTSW 5 150989151 missense probably damaging 1.00
R5687:Kl UTSW 5 150988466 missense possibly damaging 0.84
R5726:Kl UTSW 5 150991538 missense possibly damaging 0.91
R5727:Kl UTSW 5 150991538 missense possibly damaging 0.91
R5735:Kl UTSW 5 150991538 missense possibly damaging 0.91
R5797:Kl UTSW 5 150991538 missense possibly damaging 0.91
R5933:Kl UTSW 5 150989483 missense probably damaging 1.00
R6075:Kl UTSW 5 150953001 missense probably damaging 1.00
R6076:Kl UTSW 5 150953001 missense probably damaging 1.00
R6077:Kl UTSW 5 150953001 missense probably damaging 1.00
R6149:Kl UTSW 5 150988853 missense possibly damaging 0.69
R6150:Kl UTSW 5 150988853 missense possibly damaging 0.69
R6151:Kl UTSW 5 150988853 missense possibly damaging 0.69
R6158:Kl UTSW 5 150988853 missense possibly damaging 0.69
R6236:Kl UTSW 5 150953290 missense probably damaging 1.00
R6609:Kl UTSW 5 150988962 missense probably benign 0.00
R7489:Kl UTSW 5 150952996 missense probably damaging 1.00
RF005:Kl UTSW 5 150953420 missense probably benign 0.07
RF024:Kl UTSW 5 150953420 missense probably benign 0.07
X0066:Kl UTSW 5 150991615 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGGTTTCGAGTGGCATAG -3'
(R):5'- TCCCTTTGGACCTAATGGAGAG -3'

Sequencing Primer
(F):5'- TGGCATAGGGGCTACAGCATC -3'
(R):5'- CTTTGGACCTAATGGAGAGCACAAG -3'
Posted On2020-10-20