Incidental Mutation 'R8406:Dlx6'
ID652411
Institutional Source Beutler Lab
Gene Symbol Dlx6
Ensembl Gene ENSMUSG00000029754
Gene Namedistal-less homeobox 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8406 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location6863334-6868568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 6863779 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 134 (S134A)
Ref Sequence ENSEMBL: ENSMUSP00000124204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031768] [ENSMUST00000160937] [ENSMUST00000171311]
Predicted Effect probably benign
Transcript: ENSMUST00000031768
SMART Domains Protein: ENSMUSP00000031768
Gene: ENSMUSG00000029754

DomainStartEndE-ValueType
HOX 32 94 7.65e-23 SMART
low complexity region 102 118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160937
AA Change: S134A

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124204
Gene: ENSMUSG00000029754
AA Change: S134A

DomainStartEndE-ValueType
low complexity region 26 59 N/A INTRINSIC
low complexity region 79 102 N/A INTRINSIC
HOX 171 233 7.65e-23 SMART
low complexity region 241 257 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171311
AA Change: S134A

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128585
Gene: ENSMUSG00000029754
AA Change: S134A

DomainStartEndE-ValueType
low complexity region 26 59 N/A INTRINSIC
low complexity region 79 102 N/A INTRINSIC
HOX 171 233 7.65e-23 SMART
low complexity region 241 257 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a homeobox transcription factor gene family similiar to the Drosophila distal-less gene. This family is comprised of at least 6 different members that encode proteins with roles in forebrain and craniofacial development. This gene is in a tail-to-tail configuration with another member of the family on the long arm of chromosome 7. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations at both Dlx5 and Dlx6 exhibit bilateral ectrodactyly, homeotic transformation of the lower jaw into an upper jaw, and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Abca8a A G 11: 110,086,517 F139L probably damaging Het
Adgrg6 A T 10: 14,467,338 D288E probably benign Het
Agbl1 A G 7: 76,418,667 E327G Het
Aipl1 T A 11: 72,031,506 M126L possibly damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Arl3 A T 19: 46,542,384 S157T probably benign Het
Armc3 A T 2: 19,235,554 I41F probably damaging Het
Atg9a A C 1: 75,190,384 Y8D probably damaging Het
Atp10b T G 11: 43,203,157 H509Q probably benign Het
Cabyr C A 18: 12,750,747 T97K probably benign Het
Ccdc91 T C 6: 147,537,422 F174S possibly damaging Het
Cep350 A T 1: 155,922,418 H1207Q probably benign Het
Clstn3 A T 6: 124,462,177 N40K probably damaging Het
Col4a4 G A 1: 82,523,890 P381S unknown Het
Cpne5 A T 17: 29,209,481 F116Y probably benign Het
Csf2rb2 T C 15: 78,287,016 T457A probably benign Het
Cyb5d2 T C 11: 72,789,133 E112G probably benign Het
Cyp2b13 T C 7: 26,081,798 F212L probably benign Het
Egln1 A G 8: 124,911,750 Y380H probably benign Het
Fam160a1 G T 3: 85,672,720 P726Q probably benign Het
Fbxl13 A T 5: 21,523,654 I479N probably damaging Het
Fis1 A G 5: 136,963,011 K20E probably benign Het
Foxk1 G T 5: 142,401,773 V84L unknown Het
Gdf5 C A 2: 155,942,352 G227W probably damaging Het
Ghrh T A 2: 157,333,736 T13S probably benign Het
Gnb2 A G 5: 137,528,603 L308P probably damaging Het
Grik2 A T 10: 49,272,767 V574D probably damaging Het
Hydin A T 8: 110,609,911 I5107F possibly damaging Het
Kl A T 5: 150,982,764 Y533F probably benign Het
Man2b1 G T 8: 85,096,278 R816L probably damaging Het
Myo5c T C 9: 75,275,541 Y821H probably damaging Het
Myo7b A T 18: 31,959,813 C2076S probably damaging Het
Naip6 C T 13: 100,300,276 A580T possibly damaging Het
Nectin2 A T 7: 19,738,350 V38E probably damaging Het
Olfr538 A T 7: 140,574,131 probably benign Het
Osbpl9 T C 4: 109,064,573 Y536C possibly damaging Het
Pcdh18 T G 3: 49,756,549 I106L probably damaging Het
Pde4dip T C 3: 97,699,112 K2149E probably benign Het
Pds5a A T 5: 65,646,338 C588S probably benign Het
Pop1 T C 15: 34,529,170 M812T probably benign Het
Pou2f3 T C 9: 43,139,858 T178A probably damaging Het
Rab44 C T 17: 29,140,320 A494V unknown Het
Ros1 G C 10: 52,101,845 T1456S possibly damaging Het
Rubcnl T G 14: 75,051,985 F644L probably damaging Het
Saraf C T 8: 34,165,448 P227L probably benign Het
Sh3glb1 T G 3: 144,691,437 E383D probably damaging Het
Sh3rf3 T C 10: 59,083,585 V508A probably damaging Het
Sirt6 A T 10: 81,622,494 H308Q probably benign Het
Slc29a1 T A 17: 45,589,780 I119F probably damaging Het
Smtnl1 C T 2: 84,818,398 E171K probably benign Het
Spg11 T A 2: 122,093,442 E799D probably damaging Het
Tecpr1 A T 5: 144,200,840 W894R probably damaging Het
Tiam2 A C 17: 3,507,790 I1230L possibly damaging Het
Tnfrsf8 A G 4: 145,292,695 L190P probably damaging Het
Trim35 C T 14: 66,297,275 T69M possibly damaging Het
Ttll7 T C 3: 146,940,024 Y546H probably benign Het
Ubash3b C T 9: 41,029,675 G389R probably damaging Het
Vma21-ps C T 4: 52,497,034 V71I probably damaging Het
Vmn1r43 T A 6: 89,870,432 H24L possibly damaging Het
Vps37c T A 19: 10,710,355 L60Q probably damaging Het
Ythdf2 A G 4: 132,204,635 W405R probably damaging Het
Zfp775 T C 6: 48,620,703 C504R probably damaging Het
Zfp82 A G 7: 30,062,227 probably null Het
Zpr1 T A 9: 46,274,102 I127N probably damaging Het
Other mutations in Dlx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Dlx6 APN 6 6865143 missense probably damaging 1.00
IGL01081:Dlx6 APN 6 6867068 missense probably damaging 1.00
IGL03034:Dlx6 APN 6 6863807 missense probably benign 0.45
IGL03309:Dlx6 APN 6 6867289 missense possibly damaging 0.77
R0848:Dlx6 UTSW 6 6863665 nonsense probably null
R1004:Dlx6 UTSW 6 6863665 nonsense probably null
R1694:Dlx6 UTSW 6 6867173 missense probably damaging 1.00
R1753:Dlx6 UTSW 6 6863665 nonsense probably null
R2076:Dlx6 UTSW 6 6867098 missense probably benign 0.00
R2293:Dlx6 UTSW 6 6867246 missense probably damaging 1.00
R4488:Dlx6 UTSW 6 6867207 missense probably damaging 0.99
R4574:Dlx6 UTSW 6 6865305 intron probably benign
R4942:Dlx6 UTSW 6 6863468 missense probably benign 0.28
R5102:Dlx6 UTSW 6 6865180 frame shift probably null
R5103:Dlx6 UTSW 6 6865180 frame shift probably null
R5104:Dlx6 UTSW 6 6865180 frame shift probably null
R5105:Dlx6 UTSW 6 6865180 frame shift probably null
R5736:Dlx6 UTSW 6 6863660 missense probably damaging 0.97
R7577:Dlx6 UTSW 6 6863423 missense probably damaging 1.00
R7995:Dlx6 UTSW 6 6867277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACATTACCCTCTGCACTG -3'
(R):5'- TGATAAATGCGGGTCCCAGC -3'

Sequencing Primer
(F):5'- ACTGCTTGCACTCGGCC -3'
(R):5'- CCTGGAGGCTCAATGGGAAC -3'
Posted On2020-10-20