Mutagenetix > Incidental Mutation

Incidental Mutation 'R8406:Pou2f3'

652426

Institutional Source

Beutler Lab

Gene Symbol

Pou2f3

Ensembl Gene

ENSMUSG00000032015

Gene Name

POU domain, class 2, transcription factor 3

Synonyms

Otf-11, Epoc-1, Oct11, Skin, Skn-li, Skn-1a, Oct-11a, Skin-1a, Otf11

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8406 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

43123939-43210369 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 43139858 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 178 (T178A)

Ref Sequence

ENSEMBL: ENSMUSP00000034513 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034513] [ENSMUST00000176636]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000034513
AA Change: T178A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000034513
Gene: ENSMUSG00000032015
AA Change: T178A

Domain	Start	End	E-Value	Type
low complexity region	107	122	N/A	INTRINSIC
low complexity region	150	162	N/A	INTRINSIC
POU	164	238	1.47e-53	SMART
low complexity region	239	256	N/A	INTRINSIC
HOX	262	324	8.39e-20	SMART
low complexity region	337	352	N/A	INTRINSIC
low complexity region	362	378	N/A	INTRINSIC
low complexity region	386	408	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000176636
AA Change: T190A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000135115
Gene: ENSMUSG00000032015
AA Change: T190A

Domain	Start	End	E-Value	Type
low complexity region	119	134	N/A	INTRINSIC
low complexity region	162	174	N/A	INTRINSIC
POU	176	250	1.47e-53	SMART
low complexity region	251	268	N/A	INTRINSIC
HOX	274	336	8.39e-20	SMART
low complexity region	349	364	N/A	INTRINSIC
low complexity region	374	390	N/A	INTRINSIC
low complexity region	398	420	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213862

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POU domain family of transcription factors. POU domain transcription factors bind to a specific octamer DNA motif and regulate cell type-specific differentiation pathways. The encoded protein is primarily expressed in the epidermis, and plays a critical role in keratinocyte proliferation and differentiation. The encoded protein is also a candidate tumor suppressor protein, and aberrant promoter methylation of this gene may play a role in cervical cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for one null mutation exhibit defective keratinocyte differentiation, however the skin and coat appear normal. Mice homozygous for another null mutation display loss of sweet, umami and bitter taste perception and expansion of sour taste receptor cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	C	A	17: 33,067,064	A255S	probably benign	Het
Abca8a	A	G	11: 110,086,517	F139L	probably damaging	Het
Adgrg6	A	T	10: 14,467,338	D288E	probably benign	Het
Agbl1	A	G	7: 76,418,667	E327G		Het
Aipl1	T	A	11: 72,031,506	M126L	possibly damaging	Het
Alkal2	G	T	12: 30,884,851	G23V	probably damaging	Het
Arl3	A	T	19: 46,542,384	S157T	probably benign	Het
Armc3	A	T	2: 19,235,554	I41F	probably damaging	Het
Atg9a	A	C	1: 75,190,384	Y8D	probably damaging	Het
Atp10b	T	G	11: 43,203,157	H509Q	probably benign	Het
Cabyr	C	A	18: 12,750,747	T97K	probably benign	Het
Ccdc91	T	C	6: 147,537,422	F174S	possibly damaging	Het
Cep350	A	T	1: 155,922,418	H1207Q	probably benign	Het
Clstn3	A	T	6: 124,462,177	N40K	probably damaging	Het
Col4a4	G	A	1: 82,523,890	P381S	unknown	Het
Cpne5	A	T	17: 29,209,481	F116Y	probably benign	Het
Csf2rb2	T	C	15: 78,287,016	T457A	probably benign	Het
Cyb5d2	T	C	11: 72,789,133	E112G	probably benign	Het
Cyp2b13	T	C	7: 26,081,798	F212L	probably benign	Het
Dlx6	T	G	6: 6,863,779	S134A	probably benign	Het
Egln1	A	G	8: 124,911,750	Y380H	probably benign	Het
Fam160a1	G	T	3: 85,672,720	P726Q	probably benign	Het
Fbxl13	A	T	5: 21,523,654	I479N	probably damaging	Het
Fis1	A	G	5: 136,963,011	K20E	probably benign	Het
Foxk1	G	T	5: 142,401,773	V84L	unknown	Het
Gdf5	C	A	2: 155,942,352	G227W	probably damaging	Het
Ghrh	T	A	2: 157,333,736	T13S	probably benign	Het
Gnb2	A	G	5: 137,528,603	L308P	probably damaging	Het
Grik2	A	T	10: 49,272,767	V574D	probably damaging	Het
Hydin	A	T	8: 110,609,911	I5107F	possibly damaging	Het
Kl	A	T	5: 150,982,764	Y533F	probably benign	Het
Man2b1	G	T	8: 85,096,278	R816L	probably damaging	Het
Myo5c	T	C	9: 75,275,541	Y821H	probably damaging	Het
Myo7b	A	T	18: 31,959,813	C2076S	probably damaging	Het
Naip6	C	T	13: 100,300,276	A580T	possibly damaging	Het
Nectin2	A	T	7: 19,738,350	V38E	probably damaging	Het
Olfr538	A	T	7: 140,574,131		probably benign	Het
Osbpl9	T	C	4: 109,064,573	Y536C	possibly damaging	Het
Pcdh18	T	G	3: 49,756,549	I106L	probably damaging	Het
Pde4dip	T	C	3: 97,699,112	K2149E	probably benign	Het
Pds5a	A	T	5: 65,646,338	C588S	probably benign	Het
Pop1	T	C	15: 34,529,170	M812T	probably benign	Het
Rab44	C	T	17: 29,140,320	A494V	unknown	Het
Ros1	G	C	10: 52,101,845	T1456S	possibly damaging	Het
Rubcnl	T	G	14: 75,051,985	F644L	probably damaging	Het
Saraf	C	T	8: 34,165,448	P227L	probably benign	Het
Sh3glb1	T	G	3: 144,691,437	E383D	probably damaging	Het
Sh3rf3	T	C	10: 59,083,585	V508A	probably damaging	Het
Sirt6	A	T	10: 81,622,494	H308Q	probably benign	Het
Slc29a1	T	A	17: 45,589,780	I119F	probably damaging	Het
Smtnl1	C	T	2: 84,818,398	E171K	probably benign	Het
Spg11	T	A	2: 122,093,442	E799D	probably damaging	Het
Tecpr1	A	T	5: 144,200,840	W894R	probably damaging	Het
Tiam2	A	C	17: 3,507,790	I1230L	possibly damaging	Het
Tnfrsf8	A	G	4: 145,292,695	L190P	probably damaging	Het
Trim35	C	T	14: 66,297,275	T69M	possibly damaging	Het
Ttll7	T	C	3: 146,940,024	Y546H	probably benign	Het
Ubash3b	C	T	9: 41,029,675	G389R	probably damaging	Het
Vma21-ps	C	T	4: 52,497,034	V71I	probably damaging	Het
Vmn1r43	T	A	6: 89,870,432	H24L	possibly damaging	Het
Vps37c	T	A	19: 10,710,355	L60Q	probably damaging	Het
Ythdf2	A	G	4: 132,204,635	W405R	probably damaging	Het
Zfp775	T	C	6: 48,620,703	C504R	probably damaging	Het
Zfp82	A	G	7: 30,062,227		probably null	Het
Zpr1	T	A	9: 46,274,102	I127N	probably damaging	Het

Other mutations in Pou2f3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Pou2f3	APN	9	43128893	missense	probably damaging	1.00
IGL00508:Pou2f3	APN	9	43139963	missense	probably benign	0.01
IGL00975:Pou2f3	APN	9	43137384	missense	probably benign
IGL01577:Pou2f3	APN	9	43146881	nonsense	probably null
IGL01871:Pou2f3	APN	9	43134473	splice site	probably benign
IGL02370:Pou2f3	APN	9	43137348	missense	probably damaging	1.00
IGL02674:Pou2f3	APN	9	43139333	missense	probably damaging	1.00
IGL02746:Pou2f3	APN	9	43146846	missense	probably benign	0.01
IGL02956:Pou2f3	APN	9	43142805	splice site	probably benign
IGL02962:Pou2f3	APN	9	43125089	utr 3 prime	probably benign
IGL03082:Pou2f3	APN	9	43146915	critical splice acceptor site	probably null
R0433:Pou2f3	UTSW	9	43127398	missense	probably benign	0.23
R0622:Pou2f3	UTSW	9	43125119	missense	probably damaging	1.00
R0926:Pou2f3	UTSW	9	43146901	missense	probably damaging	1.00
R1956:Pou2f3	UTSW	9	43145237	missense	probably benign
R4782:Pou2f3	UTSW	9	43139858	missense	probably damaging	0.97
R4877:Pou2f3	UTSW	9	43139323	missense	possibly damaging	0.58
R5070:Pou2f3	UTSW	9	43145281	missense	possibly damaging	0.52
R5910:Pou2f3	UTSW	9	43134474	splice site	probably null
R6280:Pou2f3	UTSW	9	43139339	missense	probably damaging	1.00
R6280:Pou2f3	UTSW	9	43139340	missense	probably damaging	1.00
R6465:Pou2f3	UTSW	9	43139867	missense	probably damaging	1.00
R7084:Pou2f3	UTSW	9	43128893	missense	probably damaging	1.00
R7161:Pou2f3	UTSW	9	43139363	missense	probably damaging	1.00
R8036:Pou2f3	UTSW	9	43146908	missense	probably damaging	1.00
R8912:Pou2f3	UTSW	9	43199039	missense	probably benign	0.00
R9224:Pou2f3	UTSW	9	43139399	missense	probably damaging	1.00
R9329:Pou2f3	UTSW	9	43128929	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGAGCAATGCCCTCACTTTC -3'
(R):5'- TTCAGTAACAACTGCGGACAC -3'

Sequencing Primer
(F):5'- CCTTCCCACTAGCAACTCGTG -3'
(R):5'- GAATCTTTGTAGCTTACCATAGCGTG -3'

Posted On

2020-10-20