Incidental Mutation 'R8406:Abca8a'
ID652437
Institutional Source Beutler Lab
Gene Symbol Abca8a
Ensembl Gene ENSMUSG00000041828
Gene NameATP-binding cassette, sub-family A (ABC1), member 8a
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_153145

Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R8406 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location110025634-110095978 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110086517 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 139 (F139L)
Ref Sequence ENSEMBL: ENSMUSP00000097860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046223] [ENSMUST00000100287] [ENSMUST00000106662] [ENSMUST00000106664]
Predicted Effect probably benign
Transcript: ENSMUST00000046223
AA Change: F139L

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045808
Gene: ENSMUSG00000041828
AA Change: F139L

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 8e-26 PFAM
AAA 505 689 6.27e-9 SMART
Pfam:ABC2_membrane_3 860 1174 6.8e-15 PFAM
transmembrane domain 1196 1218 N/A INTRINSIC
low complexity region 1246 1255 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AAA 1313 1493 4.3e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100287
AA Change: F139L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097860
Gene: ENSMUSG00000041828
AA Change: F139L

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 3.9e-26 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1175 3.3e-15 PFAM
transmembrane domain 1197 1219 N/A INTRINSIC
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106662
AA Change: F84L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102273
Gene: ENSMUSG00000041828
AA Change: F84L

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106664
AA Change: F139L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102275
Gene: ENSMUSG00000041828
AA Change: F139L

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.7e-23 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1214 1.3e-12 PFAM
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Adgrg6 A T 10: 14,467,338 D288E probably benign Het
Agbl1 A G 7: 76,418,667 E327G Het
Aipl1 T A 11: 72,031,506 M126L possibly damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Arl3 A T 19: 46,542,384 S157T probably benign Het
Armc3 A T 2: 19,235,554 I41F probably damaging Het
Atg9a A C 1: 75,190,384 Y8D probably damaging Het
Atp10b T G 11: 43,203,157 H509Q probably benign Het
Cabyr C A 18: 12,750,747 T97K probably benign Het
Ccdc91 T C 6: 147,537,422 F174S possibly damaging Het
Cep350 A T 1: 155,922,418 H1207Q probably benign Het
Clstn3 A T 6: 124,462,177 N40K probably damaging Het
Col4a4 G A 1: 82,523,890 P381S unknown Het
Cpne5 A T 17: 29,209,481 F116Y probably benign Het
Csf2rb2 T C 15: 78,287,016 T457A probably benign Het
Cyb5d2 T C 11: 72,789,133 E112G probably benign Het
Cyp2b13 T C 7: 26,081,798 F212L probably benign Het
Dlx6 T G 6: 6,863,779 S134A probably benign Het
Egln1 A G 8: 124,911,750 Y380H probably benign Het
Fam160a1 G T 3: 85,672,720 P726Q probably benign Het
Fbxl13 A T 5: 21,523,654 I479N probably damaging Het
Fis1 A G 5: 136,963,011 K20E probably benign Het
Foxk1 G T 5: 142,401,773 V84L unknown Het
Gdf5 C A 2: 155,942,352 G227W probably damaging Het
Ghrh T A 2: 157,333,736 T13S probably benign Het
Gnb2 A G 5: 137,528,603 L308P probably damaging Het
Grik2 A T 10: 49,272,767 V574D probably damaging Het
Hydin A T 8: 110,609,911 I5107F possibly damaging Het
Kl A T 5: 150,982,764 Y533F probably benign Het
Man2b1 G T 8: 85,096,278 R816L probably damaging Het
Myo5c T C 9: 75,275,541 Y821H probably damaging Het
Myo7b A T 18: 31,959,813 C2076S probably damaging Het
Naip6 C T 13: 100,300,276 A580T possibly damaging Het
Nectin2 A T 7: 19,738,350 V38E probably damaging Het
Olfr538 A T 7: 140,574,131 probably benign Het
Osbpl9 T C 4: 109,064,573 Y536C possibly damaging Het
Pcdh18 T G 3: 49,756,549 I106L probably damaging Het
Pde4dip T C 3: 97,699,112 K2149E probably benign Het
Pds5a A T 5: 65,646,338 C588S probably benign Het
Pop1 T C 15: 34,529,170 M812T probably benign Het
Pou2f3 T C 9: 43,139,858 T178A probably damaging Het
Rab44 C T 17: 29,140,320 A494V unknown Het
Ros1 G C 10: 52,101,845 T1456S possibly damaging Het
Rubcnl T G 14: 75,051,985 F644L probably damaging Het
Saraf C T 8: 34,165,448 P227L probably benign Het
Sh3glb1 T G 3: 144,691,437 E383D probably damaging Het
Sh3rf3 T C 10: 59,083,585 V508A probably damaging Het
Sirt6 A T 10: 81,622,494 H308Q probably benign Het
Slc29a1 T A 17: 45,589,780 I119F probably damaging Het
Smtnl1 C T 2: 84,818,398 E171K probably benign Het
Spg11 T A 2: 122,093,442 E799D probably damaging Het
Tecpr1 A T 5: 144,200,840 W894R probably damaging Het
Tiam2 A C 17: 3,507,790 I1230L possibly damaging Het
Tnfrsf8 A G 4: 145,292,695 L190P probably damaging Het
Trim35 C T 14: 66,297,275 T69M possibly damaging Het
Ttll7 T C 3: 146,940,024 Y546H probably benign Het
Ubash3b C T 9: 41,029,675 G389R probably damaging Het
Vma21-ps C T 4: 52,497,034 V71I probably damaging Het
Vmn1r43 T A 6: 89,870,432 H24L possibly damaging Het
Vps37c T A 19: 10,710,355 L60Q probably damaging Het
Ythdf2 A G 4: 132,204,635 W405R probably damaging Het
Zfp775 T C 6: 48,620,703 C504R probably damaging Het
Zfp82 A G 7: 30,062,227 probably null Het
Zpr1 T A 9: 46,274,102 I127N probably damaging Het
Other mutations in Abca8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca8a APN 11 110050939 missense possibly damaging 0.52
IGL01099:Abca8a APN 11 110074205 splice site probably benign
IGL01100:Abca8a APN 11 110058423 critical splice donor site probably null
IGL01310:Abca8a APN 11 110059975 missense probably benign 0.02
IGL01357:Abca8a APN 11 110031572 missense probably benign 0.05
IGL01554:Abca8a APN 11 110042166 missense probably benign 0.24
IGL01937:Abca8a APN 11 110083304 splice site probably benign
IGL01945:Abca8a APN 11 110083304 splice site probably benign
IGL01987:Abca8a APN 11 110074155 missense possibly damaging 0.63
IGL02023:Abca8a APN 11 110063116 missense probably benign 0.04
IGL02208:Abca8a APN 11 110059946 missense probably damaging 1.00
IGL02378:Abca8a APN 11 110078815 unclassified probably benign
IGL02380:Abca8a APN 11 110078815 unclassified probably benign
IGL02387:Abca8a APN 11 110078815 unclassified probably benign
IGL02388:Abca8a APN 11 110078815 unclassified probably benign
IGL02524:Abca8a APN 11 110078815 unclassified probably benign
IGL02551:Abca8a APN 11 110084242 missense probably benign 0.05
IGL02831:Abca8a APN 11 110053081 missense probably damaging 1.00
IGL02836:Abca8a APN 11 110070351 missense possibly damaging 0.89
IGL02934:Abca8a APN 11 110040588 missense probably damaging 1.00
IGL02946:Abca8a APN 11 110028215 splice site probably benign
IGL02967:Abca8a APN 11 110050936 missense probably damaging 1.00
IGL02997:Abca8a APN 11 110075533 splice site probably benign
IGL03265:Abca8a APN 11 110053103 missense probably benign 0.01
G5030:Abca8a UTSW 11 110070339 missense probably damaging 1.00
H8562:Abca8a UTSW 11 110043009 missense probably benign
PIT4445001:Abca8a UTSW 11 110075551 missense probably damaging 0.99
R0060:Abca8a UTSW 11 110070480 missense probably damaging 1.00
R0060:Abca8a UTSW 11 110070480 missense probably damaging 1.00
R0084:Abca8a UTSW 11 110036597 splice site probably benign
R0394:Abca8a UTSW 11 110026343 missense probably damaging 0.99
R0477:Abca8a UTSW 11 110065225 missense probably benign
R0593:Abca8a UTSW 11 110068099 missense probably damaging 1.00
R0744:Abca8a UTSW 11 110040564 missense possibly damaging 0.91
R0764:Abca8a UTSW 11 110059946 missense probably damaging 1.00
R0787:Abca8a UTSW 11 110042988 missense possibly damaging 0.60
R0836:Abca8a UTSW 11 110040564 missense possibly damaging 0.91
R0848:Abca8a UTSW 11 110028190 missense probably damaging 1.00
R0894:Abca8a UTSW 11 110050966 missense probably benign 0.00
R1163:Abca8a UTSW 11 110071530 missense probably benign 0.01
R1224:Abca8a UTSW 11 110040582 missense probably damaging 1.00
R1474:Abca8a UTSW 11 110069809 missense probably damaging 1.00
R1596:Abca8a UTSW 11 110068060 missense possibly damaging 0.89
R1708:Abca8a UTSW 11 110053102 missense probably damaging 1.00
R1715:Abca8a UTSW 11 110091580 missense probably damaging 0.98
R1795:Abca8a UTSW 11 110050966 missense probably benign 0.00
R1832:Abca8a UTSW 11 110071451 missense probably damaging 0.99
R1852:Abca8a UTSW 11 110069386 missense probably damaging 1.00
R1887:Abca8a UTSW 11 110089942 missense probably damaging 1.00
R1891:Abca8a UTSW 11 110091607 missense probably benign 0.20
R1917:Abca8a UTSW 11 110091515 splice site probably benign
R1943:Abca8a UTSW 11 110069863 missense probably benign 0.00
R1962:Abca8a UTSW 11 110026905 critical splice acceptor site probably null
R2016:Abca8a UTSW 11 110070387 missense probably damaging 0.99
R2037:Abca8a UTSW 11 110089984 splice site probably null
R2098:Abca8a UTSW 11 110036579 missense probably damaging 1.00
R2102:Abca8a UTSW 11 110068052 missense probably damaging 1.00
R2134:Abca8a UTSW 11 110030917 missense probably null 1.00
R2220:Abca8a UTSW 11 110026855 missense probably damaging 1.00
R2269:Abca8a UTSW 11 110026892 missense probably damaging 1.00
R2395:Abca8a UTSW 11 110068788 missense probably damaging 1.00
R2847:Abca8a UTSW 11 110042105 missense probably damaging 1.00
R2849:Abca8a UTSW 11 110042105 missense probably damaging 1.00
R3508:Abca8a UTSW 11 110063165 missense probably benign
R3974:Abca8a UTSW 11 110083502 missense probably damaging 1.00
R4009:Abca8a UTSW 11 110090107 missense probably damaging 0.98
R4163:Abca8a UTSW 11 110050982 missense probably benign 0.00
R4274:Abca8a UTSW 11 110090104 missense probably damaging 0.96
R4507:Abca8a UTSW 11 110063025 missense probably benign 0.19
R4571:Abca8a UTSW 11 110030058 missense probably damaging 1.00
R4672:Abca8a UTSW 11 110071876 missense possibly damaging 0.94
R4700:Abca8a UTSW 11 110070482 missense probably damaging 1.00
R4770:Abca8a UTSW 11 110071515 missense possibly damaging 0.82
R4946:Abca8a UTSW 11 110086474 missense probably damaging 1.00
R4955:Abca8a UTSW 11 110036512 missense probably benign 0.00
R5186:Abca8a UTSW 11 110091599 missense probably null 0.31
R5190:Abca8a UTSW 11 110089909 critical splice donor site probably null
R5597:Abca8a UTSW 11 110036537 missense probably damaging 1.00
R5677:Abca8a UTSW 11 110038399 missense possibly damaging 0.51
R5757:Abca8a UTSW 11 110042968 missense probably benign 0.28
R5822:Abca8a UTSW 11 110030879 missense probably damaging 0.98
R5925:Abca8a UTSW 11 110057223 missense probably damaging 1.00
R6090:Abca8a UTSW 11 110063222 critical splice acceptor site probably null
R6122:Abca8a UTSW 11 110070423 missense probably benign 0.40
R6189:Abca8a UTSW 11 110030884 missense probably damaging 1.00
R6200:Abca8a UTSW 11 110090050 missense probably damaging 0.98
R6374:Abca8a UTSW 11 110083390 nonsense probably null
R7022:Abca8a UTSW 11 110083500 missense probably damaging 1.00
R7161:Abca8a UTSW 11 110074142 missense probably benign 0.09
R7198:Abca8a UTSW 11 110078655 missense probably damaging 1.00
R7220:Abca8a UTSW 11 110089967 missense probably benign 0.00
R7290:Abca8a UTSW 11 110030888 missense probably benign 0.03
R7381:Abca8a UTSW 11 110030087 splice site probably null
R7437:Abca8a UTSW 11 110050964 missense probably benign
R7733:Abca8a UTSW 11 110054587 missense probably benign 0.02
R7785:Abca8a UTSW 11 110074206 splice site probably null
R7917:Abca8a UTSW 11 110068107 missense probably damaging 1.00
R7948:Abca8a UTSW 11 110050979 missense probably benign
R7957:Abca8a UTSW 11 110091613 start codon destroyed probably null 1.00
R7958:Abca8a UTSW 11 110031672 missense probably damaging 1.00
R7981:Abca8a UTSW 11 110089913 missense probably benign 0.00
R8033:Abca8a UTSW 11 110036522 missense probably damaging 1.00
R8069:Abca8a UTSW 11 110090050 missense probably damaging 0.98
R8116:Abca8a UTSW 11 110091594 missense probably benign 0.27
R8289:Abca8a UTSW 11 110036689 intron probably benign
R8334:Abca8a UTSW 11 110068824 missense probably damaging 1.00
R8371:Abca8a UTSW 11 110054647 missense probably benign 0.31
R8438:Abca8a UTSW 11 110075578 missense probably damaging 1.00
R8670:Abca8a UTSW 11 110075598 missense probably damaging 1.00
R8807:Abca8a UTSW 11 110083426 missense probably benign 0.35
R8821:Abca8a UTSW 11 110058536 missense probably damaging 0.98
R8838:Abca8a UTSW 11 110030055 missense probably damaging 1.00
R8884:Abca8a UTSW 11 110074115 missense possibly damaging 0.60
R8885:Abca8a UTSW 11 110069479 missense probably damaging 1.00
R8962:Abca8a UTSW 11 110078808 missense probably damaging 1.00
X0022:Abca8a UTSW 11 110031097 missense probably damaging 1.00
X0024:Abca8a UTSW 11 110083335 missense probably damaging 1.00
X0053:Abca8a UTSW 11 110083484 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGCCTTTGTTACTGAAGCTTATTG -3'
(R):5'- CTCTCGTAGGTATTGTTTAGAGAAATG -3'

Sequencing Primer
(F):5'- ATAGTACTACCCACAGTGTGCTGG -3'
(R):5'- GGCTTCTCCGAATGAAGA -3'
Posted On2020-10-20