Incidental Mutation 'R8406:Slc29a1'
ID652448
Institutional Source Beutler Lab
Gene Symbol Slc29a1
Ensembl Gene ENSMUSG00000023942
Gene Namesolute carrier family 29 (nucleoside transporters), member 1
SynonymsENT1, 1200014D21Rik, NBMPR-sensitive equilibrative nucleoside transporter
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8406 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location45585200-45599606 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45589780 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 119 (I119F)
Ref Sequence ENSEMBL: ENSMUSP00000129242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051574] [ENSMUST00000064889] [ENSMUST00000097317] [ENSMUST00000163492] [ENSMUST00000163905] [ENSMUST00000164217] [ENSMUST00000164618] [ENSMUST00000164769] [ENSMUST00000166119] [ENSMUST00000166633] [ENSMUST00000167195] [ENSMUST00000167332] [ENSMUST00000167692] [ENSMUST00000168274] [ENSMUST00000169729] [ENSMUST00000170113] [ENSMUST00000170488] [ENSMUST00000171081] [ENSMUST00000171847] [ENSMUST00000172301]
Predicted Effect probably damaging
Transcript: ENSMUST00000051574
AA Change: I119F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063096
Gene: ENSMUSG00000023942
AA Change: I119F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 458 4.5e-131 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000064889
AA Change: I119F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063757
Gene: ENSMUSG00000023942
AA Change: I119F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 456 2.1e-130 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097317
AA Change: I119F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094923
Gene: ENSMUSG00000023942
AA Change: I119F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 458 4.5e-131 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163492
AA Change: I119F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129242
Gene: ENSMUSG00000023942
AA Change: I119F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 456 2.1e-130 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163905
AA Change: I119F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129240
Gene: ENSMUSG00000023942
AA Change: I119F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
transmembrane domain 109 130 N/A INTRINSIC
transmembrane domain 135 157 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164217
AA Change: I119F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131646
Gene: ENSMUSG00000023942
AA Change: I119F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 262 8.4e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164618
AA Change: I119F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126934
Gene: ENSMUSG00000023942
AA Change: I119F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
transmembrane domain 109 130 N/A INTRINSIC
transmembrane domain 135 157 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164769
AA Change: I119F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131116
Gene: ENSMUSG00000023942
AA Change: I119F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 358 2.7e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166119
AA Change: I119F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128763
Gene: ENSMUSG00000023942
AA Change: I119F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 458 4.5e-131 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166633
AA Change: I119F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131075
Gene: ENSMUSG00000023942
AA Change: I119F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 195 1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167195
AA Change: I87F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133162
Gene: ENSMUSG00000023942
AA Change: I87F

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 77 98 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167332
SMART Domains Protein: ENSMUSP00000131483
Gene: ENSMUSG00000023942

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167692
AA Change: I119F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131976
Gene: ENSMUSG00000023942
AA Change: I119F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 458 4.5e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168274
Predicted Effect probably damaging
Transcript: ENSMUST00000169729
AA Change: I87F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127343
Gene: ENSMUSG00000023942
AA Change: I87F

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170113
SMART Domains Protein: ENSMUSP00000128304
Gene: ENSMUSG00000023942

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170488
Predicted Effect probably damaging
Transcript: ENSMUST00000171081
AA Change: I119F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131217
Gene: ENSMUSG00000023942
AA Change: I119F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 262 8.4e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171847
AA Change: I119F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126703
Gene: ENSMUSG00000023942
AA Change: I119F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 456 2.1e-130 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172301
AA Change: I119F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129345
Gene: ENSMUSG00000023942
AA Change: I119F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the equilibrative nucleoside transporter family. The gene encodes a transmembrane glycoprotein that localizes to the plasma and mitochondrial membranes and mediates the cellular uptake of nucleosides from the surrounding medium. The protein is categorized as an equilibrative (as opposed to concentrative) transporter that is sensitive to inhibition by nitrobenzylthioinosine (NBMPR). Nucleoside transporters are required for nucleotide synthesis in cells that lack de novo nucleoside synthesis pathways, and are also necessary for the uptake of cytotoxic nucleosides used for cancer and viral chemotherapies. Multiple alternatively spliced variants, encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null allele exhibit a slightly decreased body weight, increased alcohol preference and alcohol consumption, and reduced hypnotic and ataxic responses to ethanol associated with a reduction in adenosine tone. Adenosine uptake is almost completely abolished in mice homozygous for a knock-out allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Abca8a A G 11: 110,086,517 F139L probably damaging Het
Adgrg6 A T 10: 14,467,338 D288E probably benign Het
Agbl1 A G 7: 76,418,667 E327G Het
Aipl1 T A 11: 72,031,506 M126L possibly damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Arl3 A T 19: 46,542,384 S157T probably benign Het
Armc3 A T 2: 19,235,554 I41F probably damaging Het
Atg9a A C 1: 75,190,384 Y8D probably damaging Het
Atp10b T G 11: 43,203,157 H509Q probably benign Het
Cabyr C A 18: 12,750,747 T97K probably benign Het
Ccdc91 T C 6: 147,537,422 F174S possibly damaging Het
Cep350 A T 1: 155,922,418 H1207Q probably benign Het
Clstn3 A T 6: 124,462,177 N40K probably damaging Het
Col4a4 G A 1: 82,523,890 P381S unknown Het
Cpne5 A T 17: 29,209,481 F116Y probably benign Het
Csf2rb2 T C 15: 78,287,016 T457A probably benign Het
Cyb5d2 T C 11: 72,789,133 E112G probably benign Het
Cyp2b13 T C 7: 26,081,798 F212L probably benign Het
Dlx6 T G 6: 6,863,779 S134A probably benign Het
Egln1 A G 8: 124,911,750 Y380H probably benign Het
Fam160a1 G T 3: 85,672,720 P726Q probably benign Het
Fbxl13 A T 5: 21,523,654 I479N probably damaging Het
Fis1 A G 5: 136,963,011 K20E probably benign Het
Foxk1 G T 5: 142,401,773 V84L unknown Het
Gdf5 C A 2: 155,942,352 G227W probably damaging Het
Ghrh T A 2: 157,333,736 T13S probably benign Het
Gnb2 A G 5: 137,528,603 L308P probably damaging Het
Grik2 A T 10: 49,272,767 V574D probably damaging Het
Hydin A T 8: 110,609,911 I5107F possibly damaging Het
Kl A T 5: 150,982,764 Y533F probably benign Het
Man2b1 G T 8: 85,096,278 R816L probably damaging Het
Myo5c T C 9: 75,275,541 Y821H probably damaging Het
Myo7b A T 18: 31,959,813 C2076S probably damaging Het
Naip6 C T 13: 100,300,276 A580T possibly damaging Het
Nectin2 A T 7: 19,738,350 V38E probably damaging Het
Olfr538 A T 7: 140,574,131 probably benign Het
Osbpl9 T C 4: 109,064,573 Y536C possibly damaging Het
Pcdh18 T G 3: 49,756,549 I106L probably damaging Het
Pde4dip T C 3: 97,699,112 K2149E probably benign Het
Pds5a A T 5: 65,646,338 C588S probably benign Het
Pop1 T C 15: 34,529,170 M812T probably benign Het
Pou2f3 T C 9: 43,139,858 T178A probably damaging Het
Rab44 C T 17: 29,140,320 A494V unknown Het
Ros1 G C 10: 52,101,845 T1456S possibly damaging Het
Rubcnl T G 14: 75,051,985 F644L probably damaging Het
Saraf C T 8: 34,165,448 P227L probably benign Het
Sh3glb1 T G 3: 144,691,437 E383D probably damaging Het
Sh3rf3 T C 10: 59,083,585 V508A probably damaging Het
Sirt6 A T 10: 81,622,494 H308Q probably benign Het
Smtnl1 C T 2: 84,818,398 E171K probably benign Het
Spg11 T A 2: 122,093,442 E799D probably damaging Het
Tecpr1 A T 5: 144,200,840 W894R probably damaging Het
Tiam2 A C 17: 3,507,790 I1230L possibly damaging Het
Tnfrsf8 A G 4: 145,292,695 L190P probably damaging Het
Trim35 C T 14: 66,297,275 T69M possibly damaging Het
Ttll7 T C 3: 146,940,024 Y546H probably benign Het
Ubash3b C T 9: 41,029,675 G389R probably damaging Het
Vma21-ps C T 4: 52,497,034 V71I probably damaging Het
Vmn1r43 T A 6: 89,870,432 H24L possibly damaging Het
Vps37c T A 19: 10,710,355 L60Q probably damaging Het
Ythdf2 A G 4: 132,204,635 W405R probably damaging Het
Zfp775 T C 6: 48,620,703 C504R probably damaging Het
Zfp82 A G 7: 30,062,227 probably null Het
Zpr1 T A 9: 46,274,102 I127N probably damaging Het
Other mutations in Slc29a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Slc29a1 APN 17 45589992 missense probably damaging 1.00
IGL01617:Slc29a1 APN 17 45589449 missense probably benign 0.02
IGL02154:Slc29a1 APN 17 45586163 missense probably damaging 1.00
soldate UTSW 17 45586263 missense probably damaging 1.00
veteran UTSW 17 45589921 critical splice donor site probably null
veterinarian UTSW 17 45586109 missense probably damaging 1.00
workhorse UTSW 17 45589066 nonsense probably null
R0288:Slc29a1 UTSW 17 45589804 missense probably damaging 1.00
R1168:Slc29a1 UTSW 17 45590278 missense probably damaging 1.00
R1676:Slc29a1 UTSW 17 45589010 missense probably damaging 0.98
R1777:Slc29a1 UTSW 17 45587308 missense probably damaging 1.00
R2032:Slc29a1 UTSW 17 45586109 missense probably damaging 1.00
R2413:Slc29a1 UTSW 17 45585717 missense probably damaging 1.00
R3917:Slc29a1 UTSW 17 45588973 splice site probably null
R4513:Slc29a1 UTSW 17 45589066 nonsense probably null
R4583:Slc29a1 UTSW 17 45589956 missense possibly damaging 0.67
R5244:Slc29a1 UTSW 17 45588413 unclassified probably benign
R6174:Slc29a1 UTSW 17 45589928 missense probably damaging 1.00
R6284:Slc29a1 UTSW 17 45589921 critical splice donor site probably null
R6446:Slc29a1 UTSW 17 45589245 missense possibly damaging 0.88
R6607:Slc29a1 UTSW 17 45588927 splice site probably null
R7133:Slc29a1 UTSW 17 45589971 missense possibly damaging 0.50
R7153:Slc29a1 UTSW 17 45585762 missense probably damaging 1.00
R7248:Slc29a1 UTSW 17 45592182 missense probably damaging 1.00
R7271:Slc29a1 UTSW 17 45588362 missense probably benign 0.01
R7604:Slc29a1 UTSW 17 45592324 splice site probably null
R7811:Slc29a1 UTSW 17 45586263 missense probably damaging 1.00
X0067:Slc29a1 UTSW 17 45590325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTTGCAAAATGGCACC -3'
(R):5'- AATGTCATGACCCTGTGTGC -3'

Sequencing Primer
(F):5'- GCTTGCAAAATGGCACCAAATG -3'
(R):5'- ATGACCCTGTGTGCCATGC -3'
Posted On2020-10-20