Mutagenetix > Incidental Mutation

Incidental Mutation 'R8407:Map3k6'

652460

Institutional Source

Beutler Lab

Gene Symbol

Map3k6

Ensembl Gene

ENSMUSG00000028862

Gene Name

mitogen-activated protein kinase kinase kinase 6

Synonyms

Ask2, MAPKKK6, MEKK6

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.346) question?

Stock #

R8407 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

133240818-133252929 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 133247593 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 646 (Y646N)

Ref Sequence

ENSEMBL: ENSMUSP00000030677 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030677]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030677
AA Change: Y646N

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000030677
Gene: ENSMUSG00000028862
AA Change: Y646N

Domain	Start	End	E-Value	Type
low complexity region	98	109	N/A	INTRINSIC
Pfam:DUF4071	130	508	2.3e-150	PFAM
S_TKc	649	907	3.49e-87	SMART
low complexity region	925	940	N/A	INTRINSIC
low complexity region	947	960	N/A	INTRINSIC
low complexity region	975	990	N/A	INTRINSIC
low complexity region	1130	1146	N/A	INTRINSIC
coiled coil region	1164	1195	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that forms a component of protein kinase-mediated signal transduction cascades. The encoded kinase participates in the regulation of vascular endothelial growth factor (VEGF) expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous and heterozygous null mice display an increased incidence of chemically induced skin tumors and homozygous mice also show resistance to induced apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acly	T	C	11: 100,494,071	I629V	possibly damaging	Het
Ahnak	C	T	19: 9,015,673	P4774S	probably benign	Het
Arhgef12	C	T	9: 43,026,179		probably null	Het
BC048562	T	A	9: 108,438,432	S12R	possibly damaging	Het
Calhm2	G	A	19: 47,110,316	Q310*	probably null	Het
Celsr3	A	G	9: 108,829,057	E913G	probably damaging	Het
Cep68	T	C	11: 20,240,446	S189G	possibly damaging	Het
Cilp	C	A	9: 65,274,616	P336T	probably damaging	Het
Cnot4	A	G	6: 35,056,219	S288P	probably benign	Het
Cst13	T	C	2: 148,823,204	S40P	probably damaging	Het
Cyp4f37	A	T	17: 32,634,184	D374V	probably damaging	Het
Ddit3	A	G	10: 127,295,449	T37A	probably benign	Het
Dnah2	T	C	11: 69,459,278	N2343S	probably benign	Het
Emp3	G	A	7: 45,920,021	P32L	probably damaging	Het
Esyt1	G	T	10: 128,511,927	L965M	probably damaging	Het
Fbxw28	T	A	9: 109,326,201	I406L	probably benign	Het
Fgf10	A	G	13: 118,715,402	T7A	possibly damaging	Het
Frs3	A	T	17: 47,698,627	D11V	probably damaging	Het
Glmn	A	G	5: 107,570,191	S287P	probably benign	Het
Glyctk	C	T	9: 106,155,942	A291T	probably benign	Het
Hist1h2bk	G	T	13: 22,036,047	G54V	probably damaging	Het
Ibtk	A	T	9: 85,721,066	F629I	possibly damaging	Het
Kcnh8	C	A	17: 52,905,073	A633E	probably damaging	Het
Kif24	T	C	4: 41,394,488	N929S	probably benign	Het
Ldlrap1	T	C	4: 134,757,425	K86R	probably damaging	Het
Lfng	G	A	5: 140,613,226	E297K	probably damaging	Het
Lmod1	A	G	1: 135,364,025	K206R	probably benign	Het
Lmod1	C	A	1: 135,364,996	P530T	possibly damaging	Het
Lnp1	A	T	16: 56,927,888	S14T	probably benign	Het
Mapk14	G	A	17: 28,745,009	V290I	probably benign	Het
Mrpl22	C	A	11: 58,175,330	Y83*	probably null	Het
Myh6	T	C	14: 54,963,931	N104D	probably benign	Het
Nalcn	T	A	14: 123,317,271	M903L	probably damaging	Het
Nfat5	C	T	8: 107,367,415	Q763*	probably null	Het
Olfr1152	A	C	2: 87,868,093	Y34S	probably damaging	Het
Plin1	T	C	7: 79,723,303	D306G	probably benign	Het
Ppp1r12a	T	A	10: 108,240,181		probably null	Het
Prelid1	T	A	13: 55,322,859	H33Q	probably damaging	Het
Prkcz	C	T	4: 155,268,216	A485T	probably damaging	Het
Ptch1	T	C	13: 63,514,243	E1169G	probably null	Het
Rps19	C	A	7: 24,889,092	T181K	unknown	Het
Skiv2l	G	A	17: 34,841,127	A889V	probably benign	Het
Slc22a3	A	C	17: 12,421,481	C538G	probably benign	Het
Slc2a10	T	A	2: 165,514,867	F149Y	possibly damaging	Het
Smarcal1	A	G	1: 72,601,395	I516M	probably benign	Het
Smarcc2	T	A	10: 128,482,321	W601R	probably damaging	Het
Son	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	16: 91,660,334		probably benign	Het
Srp68	A	G	11: 116,252,763	S369P	probably benign	Het
Tex2	C	T	11: 106,568,395	E70K	probably damaging	Het
Ticam2	A	G	18: 46,560,523	S166P	probably damaging	Het
Trpv5	A	G	6: 41,675,338	S138P	probably benign	Het
Ttll8	C	T	15: 88,914,538	V665I	probably benign	Het
Vmn2r81	T	C	10: 79,268,194	L217P	possibly damaging	Het
Zbtb4	T	C	11: 69,778,275	V608A	probably benign	Het
Zfp957	A	G	14: 79,213,912	V149A	possibly damaging	Het

Other mutations in Map3k6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Map3k6	APN	4	133243044	splice site	probably benign
IGL01060:Map3k6	APN	4	133247302	splice site	probably null
IGL01116:Map3k6	APN	4	133247128	missense	probably damaging	0.98
IGL01341:Map3k6	APN	4	133248060	missense	possibly damaging	0.67
IGL02383:Map3k6	APN	4	133246621	splice site	probably null
IGL03090:Map3k6	APN	4	133243366	missense	probably benign	0.05
IGL03096:Map3k6	APN	4	133251345	nonsense	probably null
IGL03149:Map3k6	APN	4	133249688	missense	probably damaging	1.00
R0110:Map3k6	UTSW	4	133243794	missense	probably damaging	1.00
R0142:Map3k6	UTSW	4	133250946	missense	probably benign
R0189:Map3k6	UTSW	4	133246941	missense	possibly damaging	0.46
R0368:Map3k6	UTSW	4	133252659	missense	probably benign	0.23
R0417:Map3k6	UTSW	4	133248082	nonsense	probably null
R0595:Map3k6	UTSW	4	133241263	missense	probably damaging	0.98
R0597:Map3k6	UTSW	4	133245552	missense	possibly damaging	0.46
R0699:Map3k6	UTSW	4	133248126	missense	probably damaging	1.00
R1099:Map3k6	UTSW	4	133247128	missense	probably damaging	1.00
R1113:Map3k6	UTSW	4	133245815	missense	probably damaging	1.00
R1308:Map3k6	UTSW	4	133245815	missense	probably damaging	1.00
R1607:Map3k6	UTSW	4	133252473	missense	probably damaging	1.00
R2217:Map3k6	UTSW	4	133246672	missense	possibly damaging	0.46
R3734:Map3k6	UTSW	4	133248396	missense	possibly damaging	0.79
R3735:Map3k6	UTSW	4	133246372	missense	probably benign	0.21
R3743:Map3k6	UTSW	4	133245073	missense	probably benign	0.26
R4244:Map3k6	UTSW	4	133251947	missense	possibly damaging	0.65
R4245:Map3k6	UTSW	4	133251947	missense	possibly damaging	0.65
R4465:Map3k6	UTSW	4	133246333	missense	possibly damaging	0.66
R4482:Map3k6	UTSW	4	133243399	missense	probably benign	0.00
R4827:Map3k6	UTSW	4	133248849	missense	possibly damaging	0.92
R5092:Map3k6	UTSW	4	133251743	missense	probably benign	0.00
R5110:Map3k6	UTSW	4	133247548	intron	probably benign
R5258:Map3k6	UTSW	4	133247642	missense	possibly damaging	0.81
R5369:Map3k6	UTSW	4	133247681	missense	probably damaging	0.99
R5642:Map3k6	UTSW	4	133245544	missense	probably damaging	0.99
R5648:Map3k6	UTSW	4	133243335	missense	probably benign	0.25
R6102:Map3k6	UTSW	4	133247131	critical splice donor site	probably null
R6144:Map3k6	UTSW	4	133245675	missense	probably damaging	1.00
R6476:Map3k6	UTSW	4	133250086	missense	probably damaging	0.98
R6511:Map3k6	UTSW	4	133248078	missense	probably damaging	0.98
R6522:Map3k6	UTSW	4	133250024	missense	possibly damaging	0.65
R6706:Map3k6	UTSW	4	133250939	nonsense	probably null
R6874:Map3k6	UTSW	4	133250656	missense	probably benign	0.02
R7069:Map3k6	UTSW	4	133251712	missense	probably benign	0.01
R7216:Map3k6	UTSW	4	133246900	missense	probably damaging	0.99
R7417:Map3k6	UTSW	4	133248396	missense	probably benign	0.43
R7538:Map3k6	UTSW	4	133251927	missense	probably benign
R7569:Map3k6	UTSW	4	133250077	missense	probably benign	0.04
R8003:Map3k6	UTSW	4	133248882	missense	probably benign	0.05
R8817:Map3k6	UTSW	4	133246760	missense	probably benign	0.00
R8939:Map3k6	UTSW	4	133252643	unclassified	probably benign
R9285:Map3k6	UTSW	4	133245559	missense	probably damaging	1.00
R9308:Map3k6	UTSW	4	133243411	missense	probably damaging	1.00
R9400:Map3k6	UTSW	4	133241156	missense	probably damaging	1.00
R9401:Map3k6	UTSW	4	133241156	missense	probably damaging	1.00
R9573:Map3k6	UTSW	4	133252463	missense	probably damaging	0.99
R9677:Map3k6	UTSW	4	133241116	missense	probably benign	0.04
R9682:Map3k6	UTSW	4	133248108	missense	possibly damaging	0.61
R9745:Map3k6	UTSW	4	133252472	missense	probably damaging	1.00
R9751:Map3k6	UTSW	4	133251857	critical splice acceptor site	probably null
Z1088:Map3k6	UTSW	4	133245066	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCAGGTTCTGTGGCCTAATTCAG -3'
(R):5'- TGTTTCCTCAACAGACAGACAG -3'

Sequencing Primer
(F):5'- CTAATTCAGGTCTTGGTGATGAATCC -3'
(R):5'- ACACACCCTGTTTGCATATACC -3'

Posted On

2020-10-20