Mutagenetix > Incidental Mutation

Incidental Mutation 'R8408:Kcnb2'

652509

Institutional Source

Beutler Lab

Gene Symbol

Kcnb2

Ensembl Gene

ENSMUSG00000092083

Gene Name

potassium voltage gated channel, Shab-related subfamily, member 2

Synonyms

9630047L19Rik, Kv2.2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8408 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

15287254-15723750 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 15711553 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 883 (N883S)

Ref Sequence

ENSEMBL: ENSMUSP00000126656 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170146] [ENSMUST00000175681]

AlphaFold

A6H8H5

Predicted Effect

probably damaging
Transcript: ENSMUST00000170146
AA Change: N883S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000175681
AA Change: N883S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000135382
Gene: ENSMUSG00000092083
AA Change: N883S

Domain	Start	End	E-Value	Type
BTB	35	144	2.59e-14	SMART
low complexity region	150	166	N/A	INTRINSIC
Pfam:Ion_trans	192	428	1.7e-51	PFAM
Pfam:Ion_trans_2	336	422	2.5e-13	PFAM
Pfam:Kv2channel	471	755	7.7e-149	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit neurological abnormalities when compared with controls, including an abnormal sleep/wake cycle, decreased exploratory and locomotor activity, and a motor strength deficit. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	A	G	12: 71,189,582	T1236A	possibly damaging	Het
9930111J21Rik1	A	T	11: 48,948,002	M586K	probably damaging	Het
Adamts4	T	C	1: 171,252,745	V289A	possibly damaging	Het
Ankrd44	A	T	1: 54,723,098	D522E	probably benign	Het
Asb14	A	G	14: 26,915,110	Y603C	probably damaging	Het
Bcl7b	A	G	5: 135,168,454		probably benign	Het
Cd5	T	C	19: 10,723,105	K345R	possibly damaging	Het
Celsr3	T	C	9: 108,831,789	F1278S	probably damaging	Het
Cndp1	T	A	18: 84,631,924	T215S	possibly damaging	Het
Crygb	T	G	1: 65,080,550	R90S	probably damaging	Het
Dlg4	T	A	11: 70,042,252	F555I	possibly damaging	Het
Dnah3	C	T	7: 119,952,505	V2864M	probably damaging	Het
Dnttip2	A	G	3: 122,276,702	E522G	probably damaging	Het
Ercc4	G	C	16: 13,130,137	R406P	probably benign	Het
Foxp1	G	A	6: 98,945,582	P430S	unknown	Het
Galnt1	A	G	18: 24,267,571	T245A	probably benign	Het
Gm13101	A	G	4: 143,965,642	V263A	probably benign	Het
Gnl2	T	A	4: 125,044,289	N287K	probably damaging	Het
Jcad	C	A	18: 4,649,402	A91E	possibly damaging	Het
Kat6a	G	A	8: 22,862,259	V20I	probably damaging	Het
Lrch3	A	T	16: 32,955,380	R205S	probably damaging	Het
Lrr1	A	G	12: 69,169,051	T66A	probably benign	Het
Lrrc37a	T	A	11: 103,460,809	I2569F	unknown	Het
Maip1	A	T	1: 57,409,943	Q161L	probably damaging	Het
Neb	T	C	2: 52,157,911	E6699G	probably benign	Het
Nup205	A	G	6: 35,225,247	R1305G	probably damaging	Het
Olfr203	A	T	16: 59,304,055	R301*	probably null	Het
Olfr378	T	A	11: 73,425,968	N5I	probably damaging	Het
Pate1	G	A	9: 35,685,122	R116W	probably damaging	Het
Pcsk5	T	G	19: 17,433,445	E1861A	probably benign	Het
Peg10	C	CTCA	6: 4,756,453		probably benign	Het
Per1	A	T	11: 69,109,127	D1215V	possibly damaging	Het
Phactr2	A	G	10: 13,253,826	S233P	probably damaging	Het
Rgsl1	T	A	1: 153,825,689	N340Y	possibly damaging	Het
Rhot1	C	T	11: 80,223,960	P65S	probably damaging	Het
Scrn2	T	C	11: 97,031,043	L113P	probably damaging	Het
Sema6a	T	C	18: 47,248,891	K863R	probably benign	Het
Slc15a1	A	G	14: 121,478,116	V337A	possibly damaging	Het
Slc25a1	T	C	16: 17,925,856	D298G	probably benign	Het
Slc25a22	G	A	7: 141,431,824	P168S	probably benign	Het
Slc29a4	A	T	5: 142,705,354		probably null	Het
Slc35d1	T	C	4: 103,189,810	T264A		Het
Spice1	T	C	16: 44,384,697	S789P	probably damaging	Het
Sprr2b	CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC	CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC	3: 92,317,519		probably benign	Het
Tectb	T	C	19: 55,189,667		probably null	Het
Ttn	T	A	2: 76,714,466	Y32764F	probably damaging	Het
Utrn	T	G	10: 12,670,143	S1684R	possibly damaging	Het
Zic1	G	T	9: 91,364,794	A75E	probably damaging	Het
Zswim4	A	G	8: 84,212,385	V956A	possibly damaging	Het

Other mutations in Kcnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Kcnb2	APN	1	15711012	missense	probably benign	0.02
IGL01321:Kcnb2	APN	1	15312923	missense	probably benign	0.09
IGL01353:Kcnb2	APN	1	15710824	missense	probably benign	0.02
IGL01990:Kcnb2	APN	1	15312954	missense	probably benign	0.19
IGL02008:Kcnb2	APN	1	15710809	missense	probably benign	0.00
IGL02120:Kcnb2	APN	1	15709861	missense	probably damaging	0.98
IGL02370:Kcnb2	APN	1	15710935	missense	probably benign
IGL02526:Kcnb2	APN	1	15710755	missense	probably damaging	1.00
IGL02859:Kcnb2	APN	1	15710506	missense	probably damaging	1.00
IGL03039:Kcnb2	APN	1	15711211	missense	probably benign
IGL03144:Kcnb2	APN	1	15709888	missense	probably damaging	1.00
F5770:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
PIT4131001:Kcnb2	UTSW	1	15312976	missense	possibly damaging	0.92
R0266:Kcnb2	UTSW	1	15712913	unclassified	probably benign
R0538:Kcnb2	UTSW	1	15712884	unclassified	probably benign
R0611:Kcnb2	UTSW	1	15710440	missense	probably benign	0.07
R1542:Kcnb2	UTSW	1	15710788	missense	probably benign	0.01
R1732:Kcnb2	UTSW	1	15709755	missense	probably benign	0.02
R1995:Kcnb2	UTSW	1	15709766	missense	possibly damaging	0.66
R2166:Kcnb2	UTSW	1	15711316	missense	possibly damaging	0.82
R2444:Kcnb2	UTSW	1	15709567	missense	probably benign
R3025:Kcnb2	UTSW	1	15710835	missense	possibly damaging	0.87
R3886:Kcnb2	UTSW	1	15710415	missense	probably damaging	1.00
R5010:Kcnb2	UTSW	1	15312962	missense	probably benign	0.09
R5039:Kcnb2	UTSW	1	15709500	missense	probably damaging	1.00
R5096:Kcnb2	UTSW	1	15710844	missense	probably benign	0.45
R5444:Kcnb2	UTSW	1	15711492	missense	probably benign
R5926:Kcnb2	UTSW	1	15313011	missense	probably benign	0.01
R6010:Kcnb2	UTSW	1	15710566	missense	possibly damaging	0.85
R6371:Kcnb2	UTSW	1	15711212	missense	probably benign
R6724:Kcnb2	UTSW	1	15710440	missense	probably damaging	1.00
R6981:Kcnb2	UTSW	1	15710256	missense	probably damaging	1.00
R7043:Kcnb2	UTSW	1	15312926	missense	probably benign
R7352:Kcnb2	UTSW	1	15710611	missense	probably benign
R7419:Kcnb2	UTSW	1	15711027	missense	possibly damaging	0.94
R7425:Kcnb2	UTSW	1	15709807	missense	probably damaging	1.00
R7606:Kcnb2	UTSW	1	15312840	missense	probably damaging	1.00
R7978:Kcnb2	UTSW	1	15710613	missense	probably benign	0.15
R7983:Kcnb2	UTSW	1	15312780	missense	probably damaging	0.98
R8115:Kcnb2	UTSW	1	15711627	makesense	probably null
R8156:Kcnb2	UTSW	1	15710056	missense	probably damaging	1.00
R8439:Kcnb2	UTSW	1	15312710	missense	probably damaging	1.00
R8726:Kcnb2	UTSW	1	15710652	missense	probably benign	0.00
R8738:Kcnb2	UTSW	1	15710424	missense	probably benign	0.07
R9274:Kcnb2	UTSW	1	15711499	missense	probably benign
R9321:Kcnb2	UTSW	1	15709569	missense	possibly damaging	0.46
R9563:Kcnb2	UTSW	1	15709513	missense	probably damaging	1.00
R9633:Kcnb2	UTSW	1	15711220	missense	probably benign
R9709:Kcnb2	UTSW	1	15710299	missense	probably benign	0.31
V7580:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7581:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7582:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7583:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
Z1088:Kcnb2	UTSW	1	15710091	missense	probably benign	0.03
Z1088:Kcnb2	UTSW	1	15711028	missense	probably benign	0.01
Z1177:Kcnb2	UTSW	1	15710958	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- CGAAGACTTCTTGGACCTCC -3'
(R):5'- TGCTCGCTATTCAGGACTCG -3'

Sequencing Primer
(F):5'- GTCAAGACCAGACAAGCAAGCAG -3'
(R):5'- AAACTATACTGTTCATGCCATGC -3'

Posted On

2020-10-20