Incidental Mutation 'R0315:Pkd2'
ID65253
Institutional Source Beutler Lab
Gene Symbol Pkd2
Ensembl Gene ENSMUSG00000034462
Gene Namepolycystic kidney disease 2
SynonymsC030034P18Rik, TRPP2, polycystin-2, PC2
MMRRC Submission 038525-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0315 (G1)
Quality Score89
Status Validated
Chromosome5
Chromosomal Location104459450-104505819 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104459850 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 72 (S72T)
Ref Sequence ENSEMBL: ENSMUSP00000084041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086831]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086831
AA Change: S72T

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084041
Gene: ENSMUSG00000034462
AA Change: S72T

DomainStartEndE-ValueType
low complexity region 25 43 N/A INTRINSIC
low complexity region 58 79 N/A INTRINSIC
low complexity region 93 115 N/A INTRINSIC
low complexity region 119 138 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
Pfam:PKD_channel 265 685 1.3e-171 PFAM
Pfam:Ion_trans 454 690 2.6e-25 PFAM
coiled coil region 765 794 N/A INTRINSIC
PDB:3HRN|A 834 893 8e-31 PDB
low complexity region 900 915 N/A INTRINSIC
low complexity region 949 963 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130931
Meta Mutation Damage Score 0.0758 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.9%
  • 20x: 88.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein is a multi-pass membrane protein that functions as a calcium permeable cation channel, and is involved in calcium transport and calcium signaling in renal epithelial cells. This protein interacts with polycystin 1, and they may be partners in a common signaling cascade involved in tubular morphogenesis. Mutations in this gene are associated with autosomal dominant polycystic kidney disease type 2. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in cardiac septation, kidney and pancreatic cysts, impaired left-right axis determination, and late-gestation lethality. Heterozygotes show kidney and liver lesions and have reduced longevity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,515,452 R409Q possibly damaging Het
Ank3 A T 10: 70,002,517 Q825L probably damaging Het
Ap1g1 A G 8: 109,819,035 I107V probably benign Het
Bub1b A T 2: 118,626,976 probably benign Het
Cd86 C T 16: 36,620,944 V54I possibly damaging Het
Dpys T G 15: 39,857,338 I9L probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 G T 3: 93,214,722 G1400C unknown Het
Gm28042 T C 2: 120,039,057 L634P probably damaging Het
Gm6712 G A 17: 17,316,118 noncoding transcript Het
Gpbp1 T G 13: 111,436,538 E360A possibly damaging Het
Hmgn1 A C 16: 96,124,817 I52R probably benign Het
Ing2 A C 8: 47,669,090 M141R probably benign Het
Klhl2 A T 8: 64,743,019 Y563* probably null Het
Lrrc9 A G 12: 72,456,028 T258A probably damaging Het
Map1b A T 13: 99,431,116 I1699N unknown Het
Map2k5 A T 9: 63,303,151 H185Q probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Mroh1 C T 15: 76,427,600 A511V possibly damaging Het
Nop53 T C 7: 15,945,310 D90G probably damaging Het
Olfr1153 A T 2: 87,897,066 Y289F probably damaging Het
Olfr1447 A T 19: 12,901,234 V182D possibly damaging Het
Olfr370 T C 8: 83,541,372 V76A possibly damaging Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Prc1 T C 7: 80,313,536 S587P probably damaging Het
Rdh7 G T 10: 127,888,396 T73K possibly damaging Het
Runx1 T C 16: 92,605,767 N429S probably damaging Het
Skint7 G A 4: 111,988,118 A376T possibly damaging Het
Slc16a14 T C 1: 84,912,496 I363V possibly damaging Het
Smarcal1 C T 1: 72,595,811 Q350* probably null Het
Soat1 T A 1: 156,440,513 K275* probably null Het
Speg T C 1: 75,415,136 V1571A possibly damaging Het
Stat5b G C 11: 100,788,460 D605E probably benign Het
Susd4 G A 1: 182,858,512 R209H probably benign Het
Tlr1 T G 5: 64,926,928 D102A probably damaging Het
Tm4sf5 A G 11: 70,510,636 N154D probably damaging Het
Tmigd3 T A 3: 105,916,769 M18K probably damaging Het
Ube2h A T 6: 30,241,413 V86E probably damaging Het
Utp20 A G 10: 88,807,421 L613P probably damaging Het
Vmn2r117 G A 17: 23,460,165 S695L probably benign Het
Washc5 T C 15: 59,341,976 D427G probably damaging Het
Zfp462 T A 4: 55,079,314 F2403I probably damaging Het
Other mutations in Pkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pkd2 APN 5 104483135 missense probably damaging 1.00
IGL01527:Pkd2 APN 5 104498884 splice site probably benign
IGL01805:Pkd2 APN 5 104483093 missense probably benign 0.41
IGL02146:Pkd2 APN 5 104489291 missense probably damaging 1.00
IGL02326:Pkd2 APN 5 104477075 missense probably benign 0.38
IGL02481:Pkd2 APN 5 104486770 missense probably damaging 1.00
IGL02952:Pkd2 APN 5 104480160 missense possibly damaging 0.48
IGL03026:Pkd2 APN 5 104494887 splice site probably benign
IGL03409:Pkd2 APN 5 104489349 nonsense probably null
Nephro UTSW 5 104486806 missense probably damaging 1.00
reggae UTSW 5 104477179 splice site probably null
samba UTSW 5 104477123 missense probably benign 0.01
IGL02988:Pkd2 UTSW 5 104503605 nonsense probably null
PIT1430001:Pkd2 UTSW 5 104459788 missense probably damaging 0.99
R0020:Pkd2 UTSW 5 104503516 missense probably damaging 1.00
R0020:Pkd2 UTSW 5 104503516 missense probably damaging 1.00
R0045:Pkd2 UTSW 5 104455805 unclassified probably benign
R0070:Pkd2 UTSW 5 104466990 missense probably damaging 0.99
R0070:Pkd2 UTSW 5 104466990 missense probably damaging 0.99
R0316:Pkd2 UTSW 5 104477166 missense probably damaging 1.00
R0570:Pkd2 UTSW 5 104455605 unclassified probably benign
R1277:Pkd2 UTSW 5 104502359 missense probably damaging 0.97
R1883:Pkd2 UTSW 5 104483228 missense probably damaging 1.00
R1907:Pkd2 UTSW 5 104486806 missense probably damaging 1.00
R1937:Pkd2 UTSW 5 104478924 missense probably damaging 1.00
R2023:Pkd2 UTSW 5 104466878 splice site probably null
R2080:Pkd2 UTSW 5 104477123 missense probably benign 0.01
R2081:Pkd2 UTSW 5 104460211 missense probably benign 0.00
R2098:Pkd2 UTSW 5 104478902 missense probably damaging 1.00
R2117:Pkd2 UTSW 5 104483176 missense probably damaging 1.00
R2146:Pkd2 UTSW 5 104455590 unclassified probably benign
R2163:Pkd2 UTSW 5 104455677 unclassified probably benign
R3401:Pkd2 UTSW 5 104480327 missense possibly damaging 0.68
R3732:Pkd2 UTSW 5 104489419 splice site probably null
R3733:Pkd2 UTSW 5 104489419 splice site probably null
R4409:Pkd2 UTSW 5 104466884 splice site silent
R4582:Pkd2 UTSW 5 104502344 nonsense probably null
R5189:Pkd2 UTSW 5 104459919 missense probably benign 0.22
R5191:Pkd2 UTSW 5 104486681 missense probably benign 0.05
R5195:Pkd2 UTSW 5 104486681 missense probably benign 0.05
R5198:Pkd2 UTSW 5 104483092 missense probably benign 0.06
R5326:Pkd2 UTSW 5 104486649 splice site silent
R5406:Pkd2 UTSW 5 104480332 missense probably damaging 1.00
R5542:Pkd2 UTSW 5 104486649 splice site silent
R5543:Pkd2 UTSW 5 104489333 missense probably damaging 1.00
R5633:Pkd2 UTSW 5 104498506 missense probably damaging 0.98
R5887:Pkd2 UTSW 5 104498539 missense probably damaging 1.00
R5906:Pkd2 UTSW 5 104477179 splice site probably null
R5924:Pkd2 UTSW 5 104498558 missense probably damaging 0.99
R6361:Pkd2 UTSW 5 104486680 nonsense probably null
R6455:Pkd2 UTSW 5 104459924 missense probably benign 0.00
R6495:Pkd2 UTSW 5 104489293 missense probably damaging 1.00
R6735:Pkd2 UTSW 5 104480329 missense probably damaging 1.00
R6837:Pkd2 UTSW 5 104477043 missense probably damaging 1.00
R7192:Pkd2 UTSW 5 104486657 missense probably benign 0.00
R7477:Pkd2 UTSW 5 104483242 missense probably benign 0.19
R7560:Pkd2 UTSW 5 104480353 missense probably damaging 1.00
R7867:Pkd2 UTSW 5 104483120 missense probably damaging 1.00
R7894:Pkd2 UTSW 5 104480237 missense probably damaging 1.00
R7950:Pkd2 UTSW 5 104483120 missense probably damaging 1.00
R7977:Pkd2 UTSW 5 104480237 missense probably damaging 1.00
R8251:Pkd2 UTSW 5 104498487 missense probably benign 0.01
Z1088:Pkd2 UTSW 5 104498861 missense probably damaging 1.00
Z1176:Pkd2 UTSW 5 104460049 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TCCGGGAAGAAAAGAACATGGCTCC -3'
(R):5'- AGCAGACAGCCACCCTTGTAGGAC -3'

Sequencing Primer
(F):5'- AACATGGCTCCTGCGGC -3'
(R):5'- TGCACTGGACGCCAAGAG -3'
Posted On2013-08-08