Incidental Mutation 'R8408:Pate1'
ID652531
Institutional Source Beutler Lab
Gene Symbol Pate1
Ensembl Gene ENSMUSG00000091215
Gene Nameprostate and testis expressed 1
SynonymsGm17252
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R8408 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location35685079-35687390 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35685122 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 116 (R116W)
Ref Sequence ENSEMBL: ENSMUSP00000130484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098906] [ENSMUST00000170021]
Predicted Effect probably benign
Transcript: ENSMUST00000098906
SMART Domains Protein: ENSMUSP00000096505
Gene: ENSMUSG00000074452

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170021
AA Change: R116W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130484
Gene: ENSMUSG00000091215
AA Change: R116W

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,189,582 T1236A possibly damaging Het
9930111J21Rik1 A T 11: 48,948,002 M586K probably damaging Het
Adamts4 T C 1: 171,252,745 V289A possibly damaging Het
Ankrd44 A T 1: 54,723,098 D522E probably benign Het
Asb14 A G 14: 26,915,110 Y603C probably damaging Het
Bcl7b A G 5: 135,168,454 probably benign Het
Cd5 T C 19: 10,723,105 K345R possibly damaging Het
Celsr3 T C 9: 108,831,789 F1278S probably damaging Het
Cndp1 T A 18: 84,631,924 T215S possibly damaging Het
Crygb T G 1: 65,080,550 R90S probably damaging Het
Dlg4 T A 11: 70,042,252 F555I possibly damaging Het
Dnah3 C T 7: 119,952,505 V2864M probably damaging Het
Dnttip2 A G 3: 122,276,702 E522G probably damaging Het
Ercc4 G C 16: 13,130,137 R406P probably benign Het
Foxp1 G A 6: 98,945,582 P430S unknown Het
Galnt1 A G 18: 24,267,571 T245A probably benign Het
Gm13101 A G 4: 143,965,642 V263A probably benign Het
Gnl2 T A 4: 125,044,289 N287K probably damaging Het
Jcad C A 18: 4,649,402 A91E possibly damaging Het
Kat6a G A 8: 22,862,259 V20I probably damaging Het
Kcnb2 A G 1: 15,711,553 N883S probably damaging Het
Lrch3 A T 16: 32,955,380 R205S probably damaging Het
Lrr1 A G 12: 69,169,051 T66A probably benign Het
Lrrc37a T A 11: 103,460,809 I2569F unknown Het
Maip1 A T 1: 57,409,943 Q161L probably damaging Het
Neb T C 2: 52,157,911 E6699G probably benign Het
Nup205 A G 6: 35,225,247 R1305G probably damaging Het
Olfr203 A T 16: 59,304,055 R301* probably null Het
Olfr378 T A 11: 73,425,968 N5I probably damaging Het
Pcsk5 T G 19: 17,433,445 E1861A probably benign Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Per1 A T 11: 69,109,127 D1215V possibly damaging Het
Phactr2 A G 10: 13,253,826 S233P probably damaging Het
Rgsl1 T A 1: 153,825,689 N340Y possibly damaging Het
Rhot1 C T 11: 80,223,960 P65S probably damaging Het
Scrn2 T C 11: 97,031,043 L113P probably damaging Het
Sema6a T C 18: 47,248,891 K863R probably benign Het
Slc15a1 A G 14: 121,478,116 V337A possibly damaging Het
Slc25a1 T C 16: 17,925,856 D298G probably benign Het
Slc25a22 G A 7: 141,431,824 P168S probably benign Het
Slc29a4 A T 5: 142,705,354 probably null Het
Slc35d1 T C 4: 103,189,810 T264A Het
Spice1 T C 16: 44,384,697 S789P probably damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Tectb T C 19: 55,189,667 probably null Het
Ttn T A 2: 76,714,466 Y32764F probably damaging Het
Utrn T G 10: 12,670,143 S1684R possibly damaging Het
Zic1 G T 9: 91,364,794 A75E probably damaging Het
Zswim4 A G 8: 84,212,385 V956A possibly damaging Het
Other mutations in Pate1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1420:Pate1 UTSW 9 35685209 missense probably damaging 1.00
R6369:Pate1 UTSW 9 35687028 missense probably benign 0.03
R7175:Pate1 UTSW 9 35685112 missense probably damaging 1.00
R7326:Pate1 UTSW 9 35685972 missense possibly damaging 0.93
R8447:Pate1 UTSW 9 35686335 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GTTTCAAAACAGGAAGGGACTTTAG -3'
(R):5'- GGTGTACAAACTCCACATGGTG -3'

Sequencing Primer
(F):5'- GGACTTTAGAAAAAGGGTGCTTTCCC -3'
(R):5'- CTCCACATGGTGATTTTTAGATGC -3'
Posted On2020-10-20