Incidental Mutation 'R8408:Slc15a1'
ID 652546
Institutional Source Beutler Lab
Gene Symbol Slc15a1
Ensembl Gene ENSMUSG00000025557
Gene Name solute carrier family 15 (oligopeptide transporter), member 1
Synonyms PECT1, PEPT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R8408 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 121459621-121505252 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121478116 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 337 (V337A)
Ref Sequence ENSEMBL: ENSMUSP00000085728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088386]
AlphaFold Q9JIP7
Predicted Effect possibly damaging
Transcript: ENSMUST00000088386
AA Change: V337A

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000085728
Gene: ENSMUSG00000025557
AA Change: V337A

DomainStartEndE-ValueType
Pfam:PTR2 81 477 1.9e-141 PFAM
Pfam:PTR2 562 644 4.2e-11 PFAM
transmembrane domain 650 672 N/A INTRINSIC
low complexity region 684 695 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intestinal hydrogen peptide cotransporter that is a member of the solute carrier family 15. The encoded protein is localized to the brush border membrane of the intestinal epithelium and mediates the uptake of di- and tripeptides from the lumen into the enterocytes. This protein plays an important role in the uptake and digestion of dietary proteins. This protein also facilitates the absorption of numerous peptidomimetic drugs. [provided by RefSeq, Apr 2010]
PHENOTYPE: Peptide uptake in the intestine is substantially reduced in mice homozygous for a null mutation of this gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,189,582 T1236A possibly damaging Het
9930111J21Rik1 A T 11: 48,948,002 M586K probably damaging Het
Adamts4 T C 1: 171,252,745 V289A possibly damaging Het
Ankrd44 A T 1: 54,723,098 D522E probably benign Het
Asb14 A G 14: 26,915,110 Y603C probably damaging Het
Bcl7b A G 5: 135,168,454 probably benign Het
Cd5 T C 19: 10,723,105 K345R possibly damaging Het
Celsr3 T C 9: 108,831,789 F1278S probably damaging Het
Cndp1 T A 18: 84,631,924 T215S possibly damaging Het
Crygb T G 1: 65,080,550 R90S probably damaging Het
Dlg4 T A 11: 70,042,252 F555I possibly damaging Het
Dnah3 C T 7: 119,952,505 V2864M probably damaging Het
Dnttip2 A G 3: 122,276,702 E522G probably damaging Het
Ercc4 G C 16: 13,130,137 R406P probably benign Het
Foxp1 G A 6: 98,945,582 P430S unknown Het
Galnt1 A G 18: 24,267,571 T245A probably benign Het
Gm13101 A G 4: 143,965,642 V263A probably benign Het
Gnl2 T A 4: 125,044,289 N287K probably damaging Het
Jcad C A 18: 4,649,402 A91E possibly damaging Het
Kat6a G A 8: 22,862,259 V20I probably damaging Het
Kcnb2 A G 1: 15,711,553 N883S probably damaging Het
Lrch3 A T 16: 32,955,380 R205S probably damaging Het
Lrr1 A G 12: 69,169,051 T66A probably benign Het
Lrrc37a T A 11: 103,460,809 I2569F unknown Het
Maip1 A T 1: 57,409,943 Q161L probably damaging Het
Neb T C 2: 52,157,911 E6699G probably benign Het
Nup205 A G 6: 35,225,247 R1305G probably damaging Het
Olfr203 A T 16: 59,304,055 R301* probably null Het
Olfr378 T A 11: 73,425,968 N5I probably damaging Het
Pate1 G A 9: 35,685,122 R116W probably damaging Het
Pcsk5 T G 19: 17,433,445 E1861A probably benign Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Per1 A T 11: 69,109,127 D1215V possibly damaging Het
Phactr2 A G 10: 13,253,826 S233P probably damaging Het
Rgsl1 T A 1: 153,825,689 N340Y possibly damaging Het
Rhot1 C T 11: 80,223,960 P65S probably damaging Het
Scrn2 T C 11: 97,031,043 L113P probably damaging Het
Sema6a T C 18: 47,248,891 K863R probably benign Het
Slc25a1 T C 16: 17,925,856 D298G probably benign Het
Slc25a22 G A 7: 141,431,824 P168S probably benign Het
Slc29a4 A T 5: 142,705,354 probably null Het
Slc35d1 T C 4: 103,189,810 T264A Het
Spice1 T C 16: 44,384,697 S789P probably damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Tectb T C 19: 55,189,667 probably null Het
Ttn T A 2: 76,714,466 Y32764F probably damaging Het
Utrn T G 10: 12,670,143 S1684R possibly damaging Het
Zic1 G T 9: 91,364,794 A75E probably damaging Het
Zswim4 A G 8: 84,212,385 V956A possibly damaging Het
Other mutations in Slc15a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01337:Slc15a1 APN 14 121460679 missense possibly damaging 0.95
IGL01534:Slc15a1 APN 14 121464952 missense possibly damaging 0.95
IGL01783:Slc15a1 APN 14 121471276 critical splice donor site probably null
IGL01799:Slc15a1 APN 14 121480729 missense possibly damaging 0.76
IGL02064:Slc15a1 APN 14 121462499 missense possibly damaging 0.66
IGL02064:Slc15a1 APN 14 121462474 missense probably benign 0.20
IGL02115:Slc15a1 APN 14 121480661 missense possibly damaging 0.61
IGL02514:Slc15a1 APN 14 121487040 missense probably damaging 1.00
IGL03056:Slc15a1 APN 14 121491283 missense possibly damaging 0.82
IGL03297:Slc15a1 APN 14 121486684 missense probably damaging 1.00
R1484:Slc15a1 UTSW 14 121491239 nonsense probably null
R1532:Slc15a1 UTSW 14 121475984 missense possibly damaging 0.79
R1655:Slc15a1 UTSW 14 121465899 missense probably benign 0.34
R2013:Slc15a1 UTSW 14 121475987 missense possibly damaging 0.88
R2270:Slc15a1 UTSW 14 121479994 missense probably damaging 0.99
R2878:Slc15a1 UTSW 14 121465933 missense probably benign 0.00
R2986:Slc15a1 UTSW 14 121489809 missense probably benign 0.02
R3862:Slc15a1 UTSW 14 121484857 missense probably benign 0.06
R3863:Slc15a1 UTSW 14 121484857 missense probably benign 0.06
R3978:Slc15a1 UTSW 14 121489827 missense probably benign 0.00
R4184:Slc15a1 UTSW 14 121466162 missense probably benign 0.00
R4573:Slc15a1 UTSW 14 121487029 missense probably damaging 0.99
R4604:Slc15a1 UTSW 14 121489907 missense probably damaging 1.00
R4649:Slc15a1 UTSW 14 121478092 missense probably damaging 1.00
R5838:Slc15a1 UTSW 14 121484871 missense probably damaging 1.00
R6221:Slc15a1 UTSW 14 121464904 missense probably null 1.00
R6891:Slc15a1 UTSW 14 121476030 missense probably benign 0.00
R7626:Slc15a1 UTSW 14 121475965 missense probably benign 0.13
R7836:Slc15a1 UTSW 14 121480733 nonsense probably null
R8284:Slc15a1 UTSW 14 121489863 missense probably benign 0.01
R8376:Slc15a1 UTSW 14 121480703 missense probably benign
R8774:Slc15a1 UTSW 14 121487011 missense probably damaging 1.00
R8774-TAIL:Slc15a1 UTSW 14 121487011 missense probably damaging 1.00
R8933:Slc15a1 UTSW 14 121486679 missense probably benign 0.00
R9157:Slc15a1 UTSW 14 121464977 missense probably benign 0.08
Z1088:Slc15a1 UTSW 14 121480054 missense probably benign 0.09
Z1088:Slc15a1 UTSW 14 121491044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGATGGGAGCTTCTGGAAG -3'
(R):5'- TAAGTTTGCCTGTCCTGGTC -3'

Sequencing Primer
(F):5'- CTTCTGGAAGCAGAGCATTTACG -3'
(R):5'- AGCTCACTTTCCAAAGCC -3'
Posted On 2020-10-20