Incidental Mutation 'R8409:H13'
ID652564
Institutional Source Beutler Lab
Gene Symbol H13
Ensembl Gene ENSMUSG00000019188
Gene Namehistocompatibility 13
SynonymsSpp, 1200006O09Rik, H-13, 5031424B04Rik, 4930443L17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8409 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location152669461-152708670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 152689893 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 239 (P239L)
Ref Sequence ENSEMBL: ENSMUSP00000086460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062148] [ENSMUST00000079247] [ENSMUST00000089059] [ENSMUST00000109825] [ENSMUST00000125366]
PDB Structure
Structure of Minor Histocompatibility Antigen peptide, H13a, complexed to H2-Db [X-RAY DIFFRACTION]
Structure of Minor Histocompatibility Antigen peptide, H13b, complexed to H2-Db [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000062148
SMART Domains Protein: ENSMUSP00000100534
Gene: ENSMUSG00000042814

DomainStartEndE-ValueType
Blast:PSN 40 63 9e-7 BLAST
PUA 93 171 3.41e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000079247
AA Change: P197L

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078236
Gene: ENSMUSG00000019188
AA Change: P197L

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
PSN 66 295 1.74e-76 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000089059
AA Change: P239L

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086460
Gene: ENSMUSG00000019188
AA Change: P239L

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
PSN 66 337 1.56e-119 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109825
SMART Domains Protein: ENSMUSP00000105450
Gene: ENSMUSG00000019188

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
Pfam:Peptidase_A22B 62 174 3.6e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125366
AA Change: P239L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120068
Gene: ENSMUSG00000019188
AA Change: P239L

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
PSN 66 337 1.56e-119 SMART
low complexity region 355 371 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, which localizes to the endoplasmic reticulum, catalyzes intramembrane proteolysis of some signal peptides after they have been cleaved from a preprotein. This activity is required to generate signal sequence-derived human lymphocyte antigen-E epitopes that are recognized by the immune system, and to process hepatitis C virus core protein. The encoded protein is an integral membrane protein with sequence motifs characteristic of the presenilin-type aspartic proteases. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: This is one of several loci identified by development of congenic strains differing in resistance to transplantable tumors. C57BL/10 carries the a allele and B10.129(14M) carries the b allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b T G 5: 121,501,477 N502H probably benign Het
Ahnak C T 19: 9,015,673 P4774S probably benign Het
Bptf A T 11: 107,062,669 S2082R probably damaging Het
Ccdc88a A G 11: 29,503,544 T1636A probably benign Het
Cep83 C T 10: 94,737,977 Q243* probably null Het
Dlg5 T G 14: 24,176,478 E452A probably damaging Het
Dsg1a T A 18: 20,340,151 D760E probably damaging Het
Elob G A 17: 23,824,959 R89C probably benign Het
En2 T C 5: 28,166,884 S120P probably benign Het
Ercc4 G C 16: 13,130,137 R406P probably benign Het
Extl2 G T 3: 116,027,262 V253F probably damaging Het
Fam217a T C 13: 34,916,898 E92G probably benign Het
Fbxo25 A T 8: 13,914,999 K17* probably null Het
Fig4 A T 10: 41,265,431 S277R probably benign Het
Gphn T C 12: 78,613,010 S429P probably damaging Het
Grm7 A G 6: 110,914,336 I177V probably benign Het
Il12rb1 T A 8: 70,816,543 S456T possibly damaging Het
Irgq A G 7: 24,533,784 D350G probably benign Het
Isl2 T C 9: 55,542,500 S118P possibly damaging Het
Itpka C T 2: 119,749,860 R329C probably damaging Het
Itpripl1 G T 2: 127,140,766 Q479K probably benign Het
Kbtbd2 T C 6: 56,780,356 N132D probably damaging Het
Klb T C 5: 65,379,535 V736A probably damaging Het
Klhl3 T C 13: 58,019,428 D374G probably damaging Het
Mmp14 T A 14: 54,440,668 V582D probably damaging Het
Naalad2 A G 9: 18,330,838 V590A probably damaging Het
Olfr136 A G 17: 38,335,306 T50A probably benign Het
Olfr566 A T 7: 102,857,270 M4K probably benign Het
Olfr871 T G 9: 20,212,246 probably benign Het
Pianp T C 6: 124,999,251 S8P unknown Het
Ppbp T C 5: 90,768,627 S9P probably damaging Het
Ppp4r3a A G 12: 101,042,493 I696T probably benign Het
Psmd5 A G 2: 34,870,844 S27P probably damaging Het
Ralgapa2 T A 2: 146,244,977 R1561S Het
Rassf8 A G 6: 145,815,703 T252A probably benign Het
Rpe65 T A 3: 159,614,148 D218E probably benign Het
Sec23ip G A 7: 128,764,131 V575I probably damaging Het
Slc38a3 G A 9: 107,659,255 probably benign Het
Slco6c1 C T 1: 97,075,938 C495Y probably damaging Het
Speer4f2 C A 5: 17,377,421 T214K Het
Stox1 A G 10: 62,666,016 L255P probably benign Het
Sympk A G 7: 19,052,438 M989V probably benign Het
Tia1 T A 6: 86,425,470 Y202N possibly damaging Het
Tmem51 TCCCC TCCC 4: 142,037,685 probably null Het
Usp34 T C 11: 23,457,811 S2593P Het
Vmn2r85 A G 10: 130,425,388 V360A probably benign Het
Other mutations in H13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02526:H13 APN 2 152688682 missense probably damaging 0.98
R0100:H13 UTSW 2 152689863 splice site probably null
R0100:H13 UTSW 2 152689863 splice site probably null
R0106:H13 UTSW 2 152686256 missense probably benign 0.09
R0178:H13 UTSW 2 152681067 missense probably damaging 1.00
R2880:H13 UTSW 2 152695561 missense probably damaging 1.00
R4058:H13 UTSW 2 152691874 missense probably damaging 1.00
R4110:H13 UTSW 2 152681109 missense probably damaging 0.99
R4397:H13 UTSW 2 152677552 missense probably damaging 0.98
R5698:H13 UTSW 2 152688955 missense probably damaging 1.00
R7145:H13 UTSW 2 152681072 missense probably damaging 1.00
R7773:H13 UTSW 2 152695511 missense probably damaging 1.00
R8116:H13 UTSW 2 152695526 missense probably damaging 1.00
R8192:H13 UTSW 2 152669602 missense probably benign
R8362:H13 UTSW 2 152686391 missense unknown
RF005:H13 UTSW 2 152669669 missense probably damaging 1.00
RF008:H13 UTSW 2 152669669 missense probably damaging 1.00
RF016:H13 UTSW 2 152669669 missense probably damaging 1.00
RF019:H13 UTSW 2 152669669 missense probably damaging 1.00
RF023:H13 UTSW 2 152669669 missense probably damaging 1.00
RF024:H13 UTSW 2 152669669 missense probably damaging 1.00
X0019:H13 UTSW 2 152681070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCAACGTCAGGTCTGCTC -3'
(R):5'- TCCTATGCTTTATGCCACATGATG -3'

Sequencing Primer
(F):5'- AACGTCAGGTCTGCTCTGAGC -3'
(R):5'- TGATGTCATGACCAAGTGGCC -3'
Posted On2020-10-20