Mutagenetix > Incidental Mutation

Incidental Mutation 'R8409:Speer4f2'

652568

Institutional Source

Beutler Lab

Gene Symbol

Speer4f2

Ensembl Gene

ENSMUSG00000091827

Gene Name

spermatogenesis associated glutamate (E)-rich protein 4f2

Synonyms

Gm3535, Gm3495

MMRRC Submission

067766-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.141) question?

Stock #

R8409 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

17373180-17378028 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 17377421 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 214 (T214K)

Ref Sequence

ENSEMBL: ENSMUSP00000129818 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166086]

AlphaFold

E9Q366

Predicted Effect

SMART Domains

Protein: ENSMUSP00000129818
Gene: ENSMUSG00000091827
AA Change: T214K

Domain	Start	End	E-Value	Type
Pfam:Takusan	34	112	9.6e-20	PFAM
low complexity region	208	253	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam1b	T	G	5: 121,501,477	N502H	probably benign	Het
Ahnak	C	T	19: 9,015,673	P4774S	probably benign	Het
Bptf	A	T	11: 107,062,669	S2082R	probably damaging	Het
Ccdc88a	A	G	11: 29,503,544	T1636A	probably benign	Het
Cep83	C	T	10: 94,737,977	Q243*	probably null	Het
Dlg5	T	G	14: 24,176,478	E452A	probably damaging	Het
Dsg1a	T	A	18: 20,340,151	D760E	probably damaging	Het
Elob	G	A	17: 23,824,959	R89C	probably benign	Het
En2	T	C	5: 28,166,884	S120P	probably benign	Het
Ercc4	G	C	16: 13,130,137	R406P	probably benign	Het
Extl2	G	T	3: 116,027,262	V253F	probably damaging	Het
Fam217a	T	C	13: 34,916,898	E92G	probably benign	Het
Fbxo25	A	T	8: 13,914,999	K17*	probably null	Het
Fig4	A	T	10: 41,265,431	S277R	probably benign	Het
Gphn	T	C	12: 78,613,010	S429P	probably damaging	Het
Grm7	A	G	6: 110,914,336	I177V	probably benign	Het
H13	C	T	2: 152,689,893	P239L	possibly damaging	Het
Il12rb1	T	A	8: 70,816,543	S456T	possibly damaging	Het
Irgq	A	G	7: 24,533,784	D350G	probably benign	Het
Isl2	T	C	9: 55,542,500	S118P	possibly damaging	Het
Itpka	C	T	2: 119,749,860	R329C	probably damaging	Het
Itpripl1	G	T	2: 127,140,766	Q479K	probably benign	Het
Kbtbd2	T	C	6: 56,780,356	N132D	probably damaging	Het
Klb	T	C	5: 65,379,535	V736A	probably damaging	Het
Klhl3	T	C	13: 58,019,428	D374G	probably damaging	Het
Mmp14	T	A	14: 54,440,668	V582D	probably damaging	Het
Naalad2	A	G	9: 18,330,838	V590A	probably damaging	Het
Olfr136	A	G	17: 38,335,306	T50A	probably benign	Het
Olfr566	A	T	7: 102,857,270	M4K	probably benign	Het
Olfr871	T	G	9: 20,212,246		probably benign	Het
Pianp	T	C	6: 124,999,251	S8P	unknown	Het
Ppbp	T	C	5: 90,768,627	S9P	probably damaging	Het
Ppp4r3a	A	G	12: 101,042,493	I696T	probably benign	Het
Psmd5	A	G	2: 34,870,844	S27P	probably damaging	Het
Ralgapa2	T	A	2: 146,244,977	R1561S		Het
Rassf8	A	G	6: 145,815,703	T252A	probably benign	Het
Rpe65	T	A	3: 159,614,148	D218E	probably benign	Het
Sec23ip	G	A	7: 128,764,131	V575I	probably damaging	Het
Slc38a3	G	A	9: 107,659,255		probably benign	Het
Slco6c1	C	T	1: 97,075,938	C495Y	probably damaging	Het
Stox1	A	G	10: 62,666,016	L255P	probably benign	Het
Sympk	A	G	7: 19,052,438	M989V	probably benign	Het
Tia1	T	A	6: 86,425,470	Y202N	possibly damaging	Het
Tmem51	TCCCC	TCCC	4: 142,037,685		probably null	Het
Usp34	T	C	11: 23,457,811	S2593P		Het
Vmn2r85	A	G	10: 130,425,388	V360A	probably benign	Het

Other mutations in Speer4f2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01505:Speer4f2	APN	5	17376567	missense	possibly damaging	0.94
IGL02092:Speer4f2	APN	5	17376629	nonsense	probably null
IGL03100:Speer4f2	APN	5	17376530	missense	probably damaging	0.99
R0939:Speer4f2	UTSW	5	17374404	missense	probably damaging	0.99
R1384:Speer4f2	UTSW	5	17374449	missense	probably damaging	1.00
R1528:Speer4f2	UTSW	5	17376542	missense
R1873:Speer4f2	UTSW	5	17374449	missense	probably damaging	1.00
R3608:Speer4f2	UTSW	5	17374494	missense	probably benign	0.03
R4972:Speer4f2	UTSW	5	17374425	missense	probably benign	0.27
R5421:Speer4f2	UTSW	5	17374358	missense	possibly damaging	0.88
R5450:Speer4f2	UTSW	5	17373219	missense	possibly damaging	0.85
R5452:Speer4f2	UTSW	5	17376500	missense	possibly damaging	0.93
R5531:Speer4f2	UTSW	5	17376528	missense	possibly damaging	0.57
R5924:Speer4f2	UTSW	5	17376624	missense	probably damaging	1.00
R6454:Speer4f2	UTSW	5	17374433	missense	probably damaging	0.99
R6553:Speer4f2	UTSW	5	17374422	missense	probably damaging	1.00
R6585:Speer4f2	UTSW	5	17374422	missense	probably damaging	1.00
R6649:Speer4f2	UTSW	5	17375769	missense	probably benign	0.05
R6878:Speer4f2	UTSW	5	17375767	missense	probably damaging	0.99
R7089:Speer4f2	UTSW	5	17376663	missense
R7129:Speer4f2	UTSW	5	17377448	missense
R7448:Speer4f2	UTSW	5	17376542	missense
R7654:Speer4f2	UTSW	5	17374415	missense
R7942:Speer4f2	UTSW	5	17377632	missense	unknown
R8170:Speer4f2	UTSW	5	17374461	missense
R9154:Speer4f2	UTSW	5	17376612	missense

Predicted Primers

PCR Primer
(F):5'- GCCTGTCTGCAGATTTAACACC -3'
(R):5'- GATTCATCTGAGAAAGATTGTGGG -3'

Sequencing Primer
(F):5'- AGCTACCATGACTTTCCCT -3'
(R):5'- CTGGAGATGGTGCTCAGCAG -3'

Posted On

2020-10-20