Incidental Mutation 'R8409:En2'
ID 652569
Institutional Source Beutler Lab
Gene Symbol En2
Ensembl Gene ENSMUSG00000039095
Gene Name engrailed 2
Synonyms En-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock # R8409 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 28165694-28172166 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 28166884 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 120 (S120P)
Ref Sequence ENSEMBL: ENSMUSP00000036761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036177]
AlphaFold P09066
Predicted Effect probably benign
Transcript: ENSMUST00000036177
AA Change: S120P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036761
Gene: ENSMUSG00000039095
AA Change: S120P

DomainStartEndE-ValueType
low complexity region 21 39 N/A INTRINSIC
low complexity region 81 112 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
HOX 235 297 1.72e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Homeobox-containing genes are thought to have a role in controlling development. In Drosophila, the 'engrailed' (en) gene plays an important role during development in segmentation, where it is required for the formation of posterior compartments. Different mutations in the mouse homologs, En1 and En2, produced different developmental defects that frequently are lethal. The human engrailed homologs 1 and 2 encode homeodomain-containing proteins and have been implicated in the control of pattern formation during development of the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: This locus affects anterior-posterior cerebellar patterning. Homozygous null mutants show altered foliation pattern and perform poorly in motor learning (rotarod) tests. Heterozygotes test intermediate on rotarod. Hypomorphs show no phenotypic effects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b T G 5: 121,501,477 N502H probably benign Het
Ahnak C T 19: 9,015,673 P4774S probably benign Het
Bptf A T 11: 107,062,669 S2082R probably damaging Het
Ccdc88a A G 11: 29,503,544 T1636A probably benign Het
Cep83 C T 10: 94,737,977 Q243* probably null Het
Dlg5 T G 14: 24,176,478 E452A probably damaging Het
Dsg1a T A 18: 20,340,151 D760E probably damaging Het
Elob G A 17: 23,824,959 R89C probably benign Het
Ercc4 G C 16: 13,130,137 R406P probably benign Het
Extl2 G T 3: 116,027,262 V253F probably damaging Het
Fam217a T C 13: 34,916,898 E92G probably benign Het
Fbxo25 A T 8: 13,914,999 K17* probably null Het
Fig4 A T 10: 41,265,431 S277R probably benign Het
Gphn T C 12: 78,613,010 S429P probably damaging Het
Grm7 A G 6: 110,914,336 I177V probably benign Het
H13 C T 2: 152,689,893 P239L possibly damaging Het
Il12rb1 T A 8: 70,816,543 S456T possibly damaging Het
Irgq A G 7: 24,533,784 D350G probably benign Het
Isl2 T C 9: 55,542,500 S118P possibly damaging Het
Itpka C T 2: 119,749,860 R329C probably damaging Het
Itpripl1 G T 2: 127,140,766 Q479K probably benign Het
Kbtbd2 T C 6: 56,780,356 N132D probably damaging Het
Klb T C 5: 65,379,535 V736A probably damaging Het
Klhl3 T C 13: 58,019,428 D374G probably damaging Het
Mmp14 T A 14: 54,440,668 V582D probably damaging Het
Naalad2 A G 9: 18,330,838 V590A probably damaging Het
Olfr136 A G 17: 38,335,306 T50A probably benign Het
Olfr566 A T 7: 102,857,270 M4K probably benign Het
Olfr871 T G 9: 20,212,246 probably benign Het
Pianp T C 6: 124,999,251 S8P unknown Het
Ppbp T C 5: 90,768,627 S9P probably damaging Het
Ppp4r3a A G 12: 101,042,493 I696T probably benign Het
Psmd5 A G 2: 34,870,844 S27P probably damaging Het
Ralgapa2 T A 2: 146,244,977 R1561S Het
Rassf8 A G 6: 145,815,703 T252A probably benign Het
Rpe65 T A 3: 159,614,148 D218E probably benign Het
Sec23ip G A 7: 128,764,131 V575I probably damaging Het
Slc38a3 G A 9: 107,659,255 probably benign Het
Slco6c1 C T 1: 97,075,938 C495Y probably damaging Het
Speer4f2 C A 5: 17,377,421 T214K Het
Stox1 A G 10: 62,666,016 L255P probably benign Het
Sympk A G 7: 19,052,438 M989V probably benign Het
Tia1 T A 6: 86,425,470 Y202N possibly damaging Het
Tmem51 TCCCC TCCC 4: 142,037,685 probably null Het
Usp34 T C 11: 23,457,811 S2593P Het
Vmn2r85 A G 10: 130,425,388 V360A probably benign Het
Other mutations in En2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02943:En2 APN 5 28166526 utr 5 prime probably benign
R0928:En2 UTSW 5 28170331 nonsense probably null
R2083:En2 UTSW 5 28167073 missense probably damaging 0.98
R2356:En2 UTSW 5 28166332 start gained probably benign
R2762:En2 UTSW 5 28170421 missense probably damaging 0.99
R5470:En2 UTSW 5 28166924 missense probably benign 0.03
R5760:En2 UTSW 5 28166999 missense probably benign 0.41
R6762:En2 UTSW 5 28170353 missense possibly damaging 0.65
R7640:En2 UTSW 5 28170166 nonsense probably null
R7687:En2 UTSW 5 28170289 missense probably damaging 1.00
R7827:En2 UTSW 5 28166596 missense probably benign
R8861:En2 UTSW 5 28166735 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGGATTCCAAGCCCAGC -3'
(R):5'- AATAGCGCGTGCAGTAGACC -3'

Sequencing Primer
(F):5'- ATGCTGCCCGAGGTCCTAC -3'
(R):5'- CTTGAGAGCTGTCCGAGTC -3'
Posted On 2020-10-20