Incidental Mutation 'R8409:Klb'
ID652570
Institutional Source Beutler Lab
Gene Symbol Klb
Ensembl Gene ENSMUSG00000029195
Gene Nameklotho beta
SynonymsbetaKlotho
MMRRC Submission
Accession Numbers

Genbank: NM_031180.2; Ensembl: ENSMUST00000031096;

MGI:1932466

Is this an essential gene? Probably essential (E-score: 0.865) question?
Stock #R8409 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location65348314-65384007 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65379535 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 736 (V736A)
Ref Sequence ENSEMBL: ENSMUSP00000031096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031096] [ENSMUST00000205084]
Predicted Effect probably damaging
Transcript: ENSMUST00000031096
AA Change: V736A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031096
Gene: ENSMUSG00000029195
AA Change: V736A

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 77 385 8.8e-96 PFAM
Pfam:Glyco_hydro_1 374 506 1.7e-31 PFAM
Pfam:Glyco_hydro_1 515 965 6.3e-80 PFAM
transmembrane domain 995 1017 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205084
SMART Domains Protein: ENSMUSP00000145091
Gene: ENSMUSG00000029195

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 77 360 8.6e-94 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype Strain: 3587748
PHENOTYPE: Homozygous null mice display increased bile acid synthesis and excretion, resistance to gallstone formation, and slightly decreased body weight. Mice homozygous for a knock-out allele or a conditional allele activated in adipose tissue exhibit resistanceto FGF21-induced metabolic disruptions. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b T G 5: 121,501,477 N502H probably benign Het
Ahnak C T 19: 9,015,673 P4774S probably benign Het
Bptf A T 11: 107,062,669 S2082R probably damaging Het
Ccdc88a A G 11: 29,503,544 T1636A probably benign Het
Cep83 C T 10: 94,737,977 Q243* probably null Het
Dlg5 T G 14: 24,176,478 E452A probably damaging Het
Dsg1a T A 18: 20,340,151 D760E probably damaging Het
Elob G A 17: 23,824,959 R89C probably benign Het
En2 T C 5: 28,166,884 S120P probably benign Het
Ercc4 G C 16: 13,130,137 R406P probably benign Het
Extl2 G T 3: 116,027,262 V253F probably damaging Het
Fam217a T C 13: 34,916,898 E92G probably benign Het
Fbxo25 A T 8: 13,914,999 K17* probably null Het
Fig4 A T 10: 41,265,431 S277R probably benign Het
Gphn T C 12: 78,613,010 S429P probably damaging Het
Grm7 A G 6: 110,914,336 I177V probably benign Het
H13 C T 2: 152,689,893 P239L possibly damaging Het
Il12rb1 T A 8: 70,816,543 S456T possibly damaging Het
Irgq A G 7: 24,533,784 D350G probably benign Het
Isl2 T C 9: 55,542,500 S118P possibly damaging Het
Itpka C T 2: 119,749,860 R329C probably damaging Het
Itpripl1 G T 2: 127,140,766 Q479K probably benign Het
Kbtbd2 T C 6: 56,780,356 N132D probably damaging Het
Klhl3 T C 13: 58,019,428 D374G probably damaging Het
Mmp14 T A 14: 54,440,668 V582D probably damaging Het
Naalad2 A G 9: 18,330,838 V590A probably damaging Het
Olfr136 A G 17: 38,335,306 T50A probably benign Het
Olfr566 A T 7: 102,857,270 M4K probably benign Het
Olfr871 T G 9: 20,212,246 probably benign Het
Pianp T C 6: 124,999,251 S8P unknown Het
Ppbp T C 5: 90,768,627 S9P probably damaging Het
Ppp4r3a A G 12: 101,042,493 I696T probably benign Het
Psmd5 A G 2: 34,870,844 S27P probably damaging Het
Ralgapa2 T A 2: 146,244,977 R1561S Het
Rassf8 A G 6: 145,815,703 T252A probably benign Het
Rpe65 T A 3: 159,614,148 D218E probably benign Het
Sec23ip G A 7: 128,764,131 V575I probably damaging Het
Slc38a3 G A 9: 107,659,255 probably benign Het
Slco6c1 C T 1: 97,075,938 C495Y probably damaging Het
Speer4f2 C A 5: 17,377,421 T214K Het
Stox1 A G 10: 62,666,016 L255P probably benign Het
Sympk A G 7: 19,052,438 M989V probably benign Het
Tia1 T A 6: 86,425,470 Y202N possibly damaging Het
Tmem51 TCCCC TCCC 4: 142,037,685 probably null Het
Usp34 T C 11: 23,457,811 S2593P Het
Vmn2r85 A G 10: 130,425,388 V360A probably benign Het
Other mutations in Klb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Klb APN 5 65372374 missense possibly damaging 0.90
IGL00821:Klb APN 5 65372149 missense probably damaging 1.00
IGL01082:Klb APN 5 65375940 missense possibly damaging 0.71
IGL01637:Klb APN 5 65375679 critical splice acceptor site probably null
IGL02098:Klb APN 5 65379885 missense probably benign 0.21
IGL03113:Klb APN 5 65383470 missense probably benign 0.00
1mM(1):Klb UTSW 5 65348650 missense probably damaging 1.00
P0016:Klb UTSW 5 65379923 nonsense probably null
R0268:Klb UTSW 5 65348837 missense probably benign 0.02
R0383:Klb UTSW 5 65372499 splice site probably null
R0676:Klb UTSW 5 65379055 missense probably damaging 1.00
R0735:Klb UTSW 5 65379727 missense probably benign
R0972:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1051:Klb UTSW 5 65379327 missense probably damaging 1.00
R1168:Klb UTSW 5 65378974 missense probably damaging 1.00
R1372:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1403:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1403:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1446:Klb UTSW 5 65348995 missense probably damaging 1.00
R1696:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1743:Klb UTSW 5 65375861 missense probably damaging 0.99
R1801:Klb UTSW 5 65349235 missense probably null 0.90
R1804:Klb UTSW 5 65379853 missense probably damaging 1.00
R1848:Klb UTSW 5 65348837 missense probably benign 0.02
R1967:Klb UTSW 5 65372074 missense probably damaging 0.98
R3420:Klb UTSW 5 65372142 missense probably damaging 1.00
R4397:Klb UTSW 5 65380039 missense probably damaging 1.00
R4490:Klb UTSW 5 65375794 missense probably benign 0.02
R4491:Klb UTSW 5 65375794 missense probably benign 0.02
R4547:Klb UTSW 5 65379928 missense probably benign 0.00
R4878:Klb UTSW 5 65348490 missense probably damaging 0.99
R5269:Klb UTSW 5 65348797 missense probably damaging 1.00
R5418:Klb UTSW 5 65383470 missense probably benign 0.00
R5453:Klb UTSW 5 65383385 missense probably benign 0.08
R5541:Klb UTSW 5 65379234 missense probably benign 0.27
R5672:Klb UTSW 5 65379949 missense possibly damaging 0.82
R5841:Klb UTSW 5 65379324 nonsense probably null
R6088:Klb UTSW 5 65349013 missense probably benign 0.07
R6807:Klb UTSW 5 65379534 missense probably damaging 1.00
R6955:Klb UTSW 5 65379088 nonsense probably null
R7068:Klb UTSW 5 65379340 missense probably damaging 1.00
R7284:Klb UTSW 5 65383478 missense probably benign 0.01
R7322:Klb UTSW 5 65383364 missense probably benign 0.44
R7346:Klb UTSW 5 65348631 nonsense probably null
R7366:Klb UTSW 5 65372431 missense probably damaging 1.00
R8134:Klb UTSW 5 65383615 missense probably benign 0.00
R8243:Klb UTSW 5 65378995 missense possibly damaging 0.65
Z1177:Klb UTSW 5 65348741 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTACGCTGAGCTGTGCTTC -3'
(R):5'- AGAAGTCGACGGTACCCTTCAC -3'

Sequencing Primer
(F):5'- AGCTGTGCTTCCGGGAG -3'
(R):5'- GGTACCCTTCACCAGCCTG -3'
Posted On2020-10-20