Incidental Mutation 'R8409:Rassf8'
ID652577
Institutional Source Beutler Lab
Gene Symbol Rassf8
Ensembl Gene ENSMUSG00000030259
Gene NameRas association (RalGDS/AF-6) domain family (N-terminal) member 8
Synonyms5133400D11Rik, mHoj-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.792) question?
Stock #R8409 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location145746748-145821079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145815703 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 252 (T252A)
Ref Sequence ENSEMBL: ENSMUSP00000032388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032388] [ENSMUST00000058538] [ENSMUST00000111704] [ENSMUST00000140966]
Predicted Effect probably benign
Transcript: ENSMUST00000032388
AA Change: T252A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032388
Gene: ENSMUSG00000030259
AA Change: T252A

DomainStartEndE-ValueType
RA 1 82 4.17e-11 SMART
coiled coil region 161 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058538
Predicted Effect probably benign
Transcript: ENSMUST00000111704
AA Change: T252A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107333
Gene: ENSMUSG00000030259
AA Change: T252A

DomainStartEndE-ValueType
RA 1 82 4.17e-11 SMART
coiled coil region 161 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140966
SMART Domains Protein: ENSMUSP00000122684
Gene: ENSMUSG00000030259

DomainStartEndE-ValueType
RA 1 80 7.85e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-assocation domain family (RASSF) of tumor suppressor proteins. This gene is essential for maintaining adherens junction function in epithelial cells and has a role in epithelial cell migration. It is a lung tumor suppressor gene candidate. A chromosomal translocation t(12;22)(p11.2;q13.3) leading to the fusion of this gene and the FBLN1 gene is found in a complex type of synpolydactyly. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b T G 5: 121,501,477 N502H probably benign Het
Ahnak C T 19: 9,015,673 P4774S probably benign Het
Bptf A T 11: 107,062,669 S2082R probably damaging Het
Ccdc88a A G 11: 29,503,544 T1636A probably benign Het
Cep83 C T 10: 94,737,977 Q243* probably null Het
Dlg5 T G 14: 24,176,478 E452A probably damaging Het
Dsg1a T A 18: 20,340,151 D760E probably damaging Het
Elob G A 17: 23,824,959 R89C probably benign Het
En2 T C 5: 28,166,884 S120P probably benign Het
Ercc4 G C 16: 13,130,137 R406P probably benign Het
Extl2 G T 3: 116,027,262 V253F probably damaging Het
Fam217a T C 13: 34,916,898 E92G probably benign Het
Fbxo25 A T 8: 13,914,999 K17* probably null Het
Fig4 A T 10: 41,265,431 S277R probably benign Het
Gphn T C 12: 78,613,010 S429P probably damaging Het
Grm7 A G 6: 110,914,336 I177V probably benign Het
H13 C T 2: 152,689,893 P239L possibly damaging Het
Il12rb1 T A 8: 70,816,543 S456T possibly damaging Het
Irgq A G 7: 24,533,784 D350G probably benign Het
Isl2 T C 9: 55,542,500 S118P possibly damaging Het
Itpka C T 2: 119,749,860 R329C probably damaging Het
Itpripl1 G T 2: 127,140,766 Q479K probably benign Het
Kbtbd2 T C 6: 56,780,356 N132D probably damaging Het
Klb T C 5: 65,379,535 V736A probably damaging Het
Klhl3 T C 13: 58,019,428 D374G probably damaging Het
Mmp14 T A 14: 54,440,668 V582D probably damaging Het
Naalad2 A G 9: 18,330,838 V590A probably damaging Het
Olfr136 A G 17: 38,335,306 T50A probably benign Het
Olfr566 A T 7: 102,857,270 M4K probably benign Het
Olfr871 T G 9: 20,212,246 probably benign Het
Pianp T C 6: 124,999,251 S8P unknown Het
Ppbp T C 5: 90,768,627 S9P probably damaging Het
Ppp4r3a A G 12: 101,042,493 I696T probably benign Het
Psmd5 A G 2: 34,870,844 S27P probably damaging Het
Ralgapa2 T A 2: 146,244,977 R1561S Het
Rpe65 T A 3: 159,614,148 D218E probably benign Het
Sec23ip G A 7: 128,764,131 V575I probably damaging Het
Slc38a3 G A 9: 107,659,255 probably benign Het
Slco6c1 C T 1: 97,075,938 C495Y probably damaging Het
Speer4f2 C A 5: 17,377,421 T214K Het
Stox1 A G 10: 62,666,016 L255P probably benign Het
Sympk A G 7: 19,052,438 M989V probably benign Het
Tia1 T A 6: 86,425,470 Y202N possibly damaging Het
Tmem51 TCCCC TCCC 4: 142,037,685 probably null Het
Usp34 T C 11: 23,457,811 S2593P Het
Vmn2r85 A G 10: 130,425,388 V360A probably benign Het
Other mutations in Rassf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02973:Rassf8 APN 6 145817190 unclassified probably benign
IGL03017:Rassf8 APN 6 145817198 splice site probably null
IGL03091:Rassf8 APN 6 145815810 missense probably benign 0.00
R0230:Rassf8 UTSW 6 145819974 unclassified probably benign
R0967:Rassf8 UTSW 6 145819950 unclassified probably benign
R1429:Rassf8 UTSW 6 145815190 missense probably damaging 1.00
R1622:Rassf8 UTSW 6 145820103 unclassified probably benign
R1738:Rassf8 UTSW 6 145815308 missense probably benign 0.03
R1894:Rassf8 UTSW 6 145808473 missense probably damaging 1.00
R2126:Rassf8 UTSW 6 145815182 missense probably benign 0.00
R2238:Rassf8 UTSW 6 145817184 missense probably damaging 1.00
R2439:Rassf8 UTSW 6 145815334 missense probably damaging 1.00
R3699:Rassf8 UTSW 6 145820076 unclassified probably benign
R4678:Rassf8 UTSW 6 145815082 missense probably damaging 1.00
R4734:Rassf8 UTSW 6 145815540 missense probably benign 0.34
R4826:Rassf8 UTSW 6 145816550 missense probably damaging 1.00
R4910:Rassf8 UTSW 6 145815280 nonsense probably null
R4988:Rassf8 UTSW 6 145817144 missense possibly damaging 0.89
R5425:Rassf8 UTSW 6 145815542 missense probably benign
R5620:Rassf8 UTSW 6 145820181 unclassified probably benign
R5747:Rassf8 UTSW 6 145815815 missense probably benign 0.00
R6136:Rassf8 UTSW 6 145815656 missense probably benign 0.00
R6220:Rassf8 UTSW 6 145817133 missense probably damaging 1.00
R7274:Rassf8 UTSW 6 145815569 missense probably benign 0.03
R7315:Rassf8 UTSW 6 145815751 missense probably benign
R7480:Rassf8 UTSW 6 145820031 missense unknown
R7593:Rassf8 UTSW 6 145815403 missense probably benign 0.08
R7714:Rassf8 UTSW 6 145815247 missense probably damaging 0.98
R7962:Rassf8 UTSW 6 145815943 critical splice donor site probably null
R8222:Rassf8 UTSW 6 145820057 missense unknown
R8374:Rassf8 UTSW 6 145815137 nonsense probably null
Z1088:Rassf8 UTSW 6 145815482 missense probably benign
Z1088:Rassf8 UTSW 6 145816616 missense probably benign 0.41
Z1176:Rassf8 UTSW 6 145816642 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGAAGTACAGCTGTAGCCTG -3'
(R):5'- TTACCTGTAGCCGCTTGGTG -3'

Sequencing Primer
(F):5'- CCTGGAGGAGGAGATTGTCC -3'
(R):5'- GAGACCTCTCCACAGCTCTAATG -3'
Posted On2020-10-20