Incidental Mutation 'R8409:Sympk'
ID652578
Institutional Source Beutler Lab
Gene Symbol Sympk
Ensembl Gene ENSMUSG00000023118
Gene Namesymplekin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R8409 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location19024377-19054618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19052438 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 989 (M989V)
Ref Sequence ENSEMBL: ENSMUSP00000023882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023882] [ENSMUST00000035521] [ENSMUST00000076887] [ENSMUST00000146903]
Predicted Effect probably benign
Transcript: ENSMUST00000023882
AA Change: M989V

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000023882
Gene: ENSMUSG00000023118
AA Change: M989V

DomainStartEndE-ValueType
low complexity region 106 118 N/A INTRINSIC
Pfam:DUF3453 119 352 1.1e-63 PFAM
low complexity region 473 485 N/A INTRINSIC
Pfam:Symplekin_C 887 1068 4.3e-78 PFAM
low complexity region 1123 1149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035521
SMART Domains Protein: ENSMUSP00000046526
Gene: ENSMUSG00000040866

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:Radial_spoke 191 685 2.3e-200 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076887
SMART Domains Protein: ENSMUSP00000076153
Gene: ENSMUSG00000040866

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:Radial_spoke 188 287 3e-18 PFAM
Pfam:Radial_spoke 285 433 4.6e-53 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000115900
Gene: ENSMUSG00000023118
AA Change: M12V

DomainStartEndE-ValueType
Pfam:Symplekin_C 1 92 3.9e-44 PFAM
low complexity region 125 143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146903
SMART Domains Protein: ENSMUSP00000138740
Gene: ENSMUSG00000023118

DomainStartEndE-ValueType
Pfam:DUF3453 117 230 1.1e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that functions in the regulation of polyadenylation and promotes gene expression. The protein forms a high-molecular weight complex with components of the polyadenylation machinery. It is thought to serve as a scaffold for recruiting regulatory factors to the polyadenylation complex. It also participates in 3'-end maturation of histone mRNAs, which do not undergo polyadenylation. The protein also localizes to the cytoplasmic plaques of tight junctions in some cell types. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous ofr a transgenic gene disruption exhibit anemia at E15 and hydrops fetalis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b T G 5: 121,501,477 N502H probably benign Het
Ahnak C T 19: 9,015,673 P4774S probably benign Het
Bptf A T 11: 107,062,669 S2082R probably damaging Het
Ccdc88a A G 11: 29,503,544 T1636A probably benign Het
Cep83 C T 10: 94,737,977 Q243* probably null Het
Dlg5 T G 14: 24,176,478 E452A probably damaging Het
Dsg1a T A 18: 20,340,151 D760E probably damaging Het
Elob G A 17: 23,824,959 R89C probably benign Het
En2 T C 5: 28,166,884 S120P probably benign Het
Ercc4 G C 16: 13,130,137 R406P probably benign Het
Extl2 G T 3: 116,027,262 V253F probably damaging Het
Fam217a T C 13: 34,916,898 E92G probably benign Het
Fbxo25 A T 8: 13,914,999 K17* probably null Het
Fig4 A T 10: 41,265,431 S277R probably benign Het
Gphn T C 12: 78,613,010 S429P probably damaging Het
Grm7 A G 6: 110,914,336 I177V probably benign Het
H13 C T 2: 152,689,893 P239L possibly damaging Het
Il12rb1 T A 8: 70,816,543 S456T possibly damaging Het
Irgq A G 7: 24,533,784 D350G probably benign Het
Isl2 T C 9: 55,542,500 S118P possibly damaging Het
Itpka C T 2: 119,749,860 R329C probably damaging Het
Itpripl1 G T 2: 127,140,766 Q479K probably benign Het
Kbtbd2 T C 6: 56,780,356 N132D probably damaging Het
Klb T C 5: 65,379,535 V736A probably damaging Het
Klhl3 T C 13: 58,019,428 D374G probably damaging Het
Mmp14 T A 14: 54,440,668 V582D probably damaging Het
Naalad2 A G 9: 18,330,838 V590A probably damaging Het
Olfr136 A G 17: 38,335,306 T50A probably benign Het
Olfr566 A T 7: 102,857,270 M4K probably benign Het
Olfr871 T G 9: 20,212,246 probably benign Het
Pianp T C 6: 124,999,251 S8P unknown Het
Ppbp T C 5: 90,768,627 S9P probably damaging Het
Ppp4r3a A G 12: 101,042,493 I696T probably benign Het
Psmd5 A G 2: 34,870,844 S27P probably damaging Het
Ralgapa2 T A 2: 146,244,977 R1561S Het
Rassf8 A G 6: 145,815,703 T252A probably benign Het
Rpe65 T A 3: 159,614,148 D218E probably benign Het
Sec23ip G A 7: 128,764,131 V575I probably damaging Het
Slc38a3 G A 9: 107,659,255 probably benign Het
Slco6c1 C T 1: 97,075,938 C495Y probably damaging Het
Speer4f2 C A 5: 17,377,421 T214K Het
Stox1 A G 10: 62,666,016 L255P probably benign Het
Tia1 T A 6: 86,425,470 Y202N possibly damaging Het
Tmem51 TCCCC TCCC 4: 142,037,685 probably null Het
Usp34 T C 11: 23,457,811 S2593P Het
Vmn2r85 A G 10: 130,425,388 V360A probably benign Het
Other mutations in Sympk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Sympk APN 7 19047573 missense probably benign 0.14
IGL01834:Sympk APN 7 19043435 missense probably benign 0.02
IGL02588:Sympk APN 7 19042625 missense probably benign
IGL02601:Sympk APN 7 19048869 missense probably benign 0.31
IGL02645:Sympk APN 7 19052424 missense probably damaging 0.99
IGL02698:Sympk APN 7 19045634 missense probably benign 0.35
IGL02709:Sympk APN 7 19047538 missense probably benign 0.26
IGL02814:Sympk APN 7 19053273 missense probably damaging 1.00
IGL03198:Sympk APN 7 19044996 missense possibly damaging 0.92
butterfinger UTSW 7 19048453 missense probably damaging 0.98
fifth_avenue UTSW 7 19043460 missense possibly damaging 0.83
IGL02991:Sympk UTSW 7 19030577 missense probably damaging 1.00
R0391:Sympk UTSW 7 19046849 missense probably benign 0.06
R1036:Sympk UTSW 7 19048453 missense probably damaging 0.98
R1872:Sympk UTSW 7 19029145 missense probably benign
R2058:Sympk UTSW 7 19043529 missense probably damaging 1.00
R2103:Sympk UTSW 7 19054116 missense probably benign
R2966:Sympk UTSW 7 19030544 missense probably damaging 1.00
R3110:Sympk UTSW 7 19034484 missense possibly damaging 0.69
R3112:Sympk UTSW 7 19034484 missense possibly damaging 0.69
R3703:Sympk UTSW 7 19040561 missense probably damaging 0.99
R3775:Sympk UTSW 7 19035955 missense probably damaging 1.00
R3930:Sympk UTSW 7 19047522 missense possibly damaging 0.90
R4638:Sympk UTSW 7 19043460 missense possibly damaging 0.83
R4639:Sympk UTSW 7 19043460 missense possibly damaging 0.83
R4645:Sympk UTSW 7 19043460 missense possibly damaging 0.83
R4688:Sympk UTSW 7 19054410 missense probably benign
R5050:Sympk UTSW 7 19036042 missense probably benign 0.19
R5051:Sympk UTSW 7 19036042 missense probably benign 0.19
R5052:Sympk UTSW 7 19036042 missense probably benign 0.19
R5092:Sympk UTSW 7 19042659 missense probably benign 0.17
R5211:Sympk UTSW 7 19035889 missense probably benign 0.22
R5591:Sympk UTSW 7 19054039 missense probably damaging 1.00
R5678:Sympk UTSW 7 19049472 critical splice donor site probably null
R5972:Sympk UTSW 7 19046824 missense probably benign
R6387:Sympk UTSW 7 19052498 missense possibly damaging 0.94
R6543:Sympk UTSW 7 19036830 missense probably damaging 1.00
R6984:Sympk UTSW 7 19038043 missense probably benign 0.00
R7141:Sympk UTSW 7 19054092 missense probably benign
R7292:Sympk UTSW 7 19036030 missense probably benign 0.01
R7319:Sympk UTSW 7 19035845 missense probably benign
R7887:Sympk UTSW 7 19034439 missense possibly damaging 0.69
R8094:Sympk UTSW 7 19053448 critical splice donor site probably null
R8147:Sympk UTSW 7 19036793 missense probably damaging 0.98
RF064:Sympk UTSW 7 19034395 frame shift probably null
X0017:Sympk UTSW 7 19040663 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGGTCCAGCGTGCATTATCC -3'
(R):5'- ACCTGAGGTTTGTCCCACTG -3'

Sequencing Primer
(F):5'- GCAGAGTCATTGAGTAGCCTC -3'
(R):5'- TGTCCCACTGTGGCTGACTG -3'
Posted On2020-10-20