Incidental Mutation 'R8409:Dlg5'
ID 652599
Institutional Source Beutler Lab
Gene Symbol Dlg5
Ensembl Gene ENSMUSG00000021782
Gene Name discs large MAGUK scaffold protein 5
Synonyms 4933429D20Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001163513; MGI: 1918478
Essential gene? Essential (E-score: 1.000) question?
Stock # R8409 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 24133953-24245920 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 24176478 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 452 (E452A)
Ref Sequence ENSEMBL: ENSMUSP00000087879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042009] [ENSMUST00000073687] [ENSMUST00000090398]
AlphaFold E9Q9R9
Predicted Effect possibly damaging
Transcript: ENSMUST00000042009
AA Change: E98A

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044852
Gene: ENSMUSG00000021782
AA Change: E98A

DomainStartEndE-ValueType
coiled coil region 20 247 N/A INTRINSIC
low complexity region 261 274 N/A INTRINSIC
PDZ 279 356 2.02e-10 SMART
PDZ 364 447 9.5e-16 SMART
low complexity region 510 517 N/A INTRINSIC
low complexity region 692 711 N/A INTRINSIC
low complexity region 903 918 N/A INTRINSIC
PDZ 1009 1080 2.1e-17 SMART
PDZ 1164 1236 2.97e-8 SMART
SH3 1250 1314 3.73e-7 SMART
low complexity region 1338 1358 N/A INTRINSIC
GuKc 1375 1561 5.43e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073687
AA Change: E429A

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073367
Gene: ENSMUSG00000021782
AA Change: E429A

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 22 36 N/A INTRINSIC
low complexity region 44 66 N/A INTRINSIC
Pfam:Takusan 104 191 1.4e-27 PFAM
coiled coil region 308 578 N/A INTRINSIC
low complexity region 592 605 N/A INTRINSIC
PDZ 610 687 2.02e-10 SMART
PDZ 695 773 1.25e-15 SMART
low complexity region 836 843 N/A INTRINSIC
low complexity region 1018 1037 N/A INTRINSIC
low complexity region 1229 1244 N/A INTRINSIC
PDZ 1335 1406 2.1e-17 SMART
PDZ 1490 1562 2.97e-8 SMART
SH3 1576 1640 3.73e-7 SMART
low complexity region 1664 1684 N/A INTRINSIC
GuKc 1701 1887 5.43e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000090398
AA Change: E452A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000087879
Gene: ENSMUSG00000021782
AA Change: E452A

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 22 36 N/A INTRINSIC
low complexity region 44 66 N/A INTRINSIC
low complexity region 109 123 N/A INTRINSIC
Pfam:Takusan 128 213 6e-33 PFAM
coiled coil region 331 601 N/A INTRINSIC
low complexity region 615 628 N/A INTRINSIC
PDZ 633 710 2.02e-10 SMART
PDZ 718 796 1.25e-15 SMART
low complexity region 859 866 N/A INTRINSIC
low complexity region 1041 1060 N/A INTRINSIC
low complexity region 1252 1267 N/A INTRINSIC
PDZ 1358 1429 2.1e-17 SMART
PDZ 1513 1585 2.97e-8 SMART
SH3 1599 1663 3.73e-7 SMART
low complexity region 1687 1707 N/A INTRINSIC
GuKc 1724 1910 5.43e-53 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of discs large (DLG) homologs, a subset of the membrane-associated guanylate kinase (MAGUK) superfamily. The MAGUK proteins are composed of a catalytically inactive guanylate kinase domain, in addition to PDZ and SH3 domains, and are thought to function as scaffolding molecules at sites of cell-cell contact. The protein encoded by this gene localizes to the plasma membrane and cytoplasm, and interacts with components of adherens junctions and the cytoskeleton. It is proposed to function in the transmission of extracellular signals to the cytoskeleton and in the maintenance of epithelial cell structure. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit growth retardation, hydroencephaly, abnormal brain morphology, abnormal neurogenesis, kidney cysts, ureter defects, and abnormal kidney morphology. [provided by MGI curators]
Allele List at MGI

All alleles(19) : Targeted, other(1) Gene trapped(18)
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b T G 5: 121,501,477 N502H probably benign Het
Ahnak C T 19: 9,015,673 P4774S probably benign Het
Bptf A T 11: 107,062,669 S2082R probably damaging Het
Ccdc88a A G 11: 29,503,544 T1636A probably benign Het
Cep83 C T 10: 94,737,977 Q243* probably null Het
Dsg1a T A 18: 20,340,151 D760E probably damaging Het
Elob G A 17: 23,824,959 R89C probably benign Het
En2 T C 5: 28,166,884 S120P probably benign Het
Ercc4 G C 16: 13,130,137 R406P probably benign Het
Extl2 G T 3: 116,027,262 V253F probably damaging Het
Fam217a T C 13: 34,916,898 E92G probably benign Het
Fbxo25 A T 8: 13,914,999 K17* probably null Het
Fig4 A T 10: 41,265,431 S277R probably benign Het
Gphn T C 12: 78,613,010 S429P probably damaging Het
Grm7 A G 6: 110,914,336 I177V probably benign Het
H13 C T 2: 152,689,893 P239L possibly damaging Het
Il12rb1 T A 8: 70,816,543 S456T possibly damaging Het
Irgq A G 7: 24,533,784 D350G probably benign Het
Isl2 T C 9: 55,542,500 S118P possibly damaging Het
Itpka C T 2: 119,749,860 R329C probably damaging Het
Itpripl1 G T 2: 127,140,766 Q479K probably benign Het
Kbtbd2 T C 6: 56,780,356 N132D probably damaging Het
Klb T C 5: 65,379,535 V736A probably damaging Het
Klhl3 T C 13: 58,019,428 D374G probably damaging Het
Mmp14 T A 14: 54,440,668 V582D probably damaging Het
Naalad2 A G 9: 18,330,838 V590A probably damaging Het
Olfr136 A G 17: 38,335,306 T50A probably benign Het
Olfr566 A T 7: 102,857,270 M4K probably benign Het
Olfr871 T G 9: 20,212,246 probably benign Het
Pianp T C 6: 124,999,251 S8P unknown Het
Ppbp T C 5: 90,768,627 S9P probably damaging Het
Ppp4r3a A G 12: 101,042,493 I696T probably benign Het
Psmd5 A G 2: 34,870,844 S27P probably damaging Het
Ralgapa2 T A 2: 146,244,977 R1561S Het
Rassf8 A G 6: 145,815,703 T252A probably benign Het
Rpe65 T A 3: 159,614,148 D218E probably benign Het
Sec23ip G A 7: 128,764,131 V575I probably damaging Het
Slc38a3 G A 9: 107,659,255 probably benign Het
Slco6c1 C T 1: 97,075,938 C495Y probably damaging Het
Speer4f2 C A 5: 17,377,421 T214K Het
Stox1 A G 10: 62,666,016 L255P probably benign Het
Sympk A G 7: 19,052,438 M989V probably benign Het
Tia1 T A 6: 86,425,470 Y202N possibly damaging Het
Tmem51 TCCCC TCCC 4: 142,037,685 probably null Het
Usp34 T C 11: 23,457,811 S2593P Het
Vmn2r85 A G 10: 130,425,388 V360A probably benign Het
Other mutations in Dlg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Dlg5 APN 14 24191161 missense probably damaging 0.99
IGL00164:Dlg5 APN 14 24158464 missense possibly damaging 0.89
IGL00767:Dlg5 APN 14 24165285 missense probably damaging 1.00
IGL01284:Dlg5 APN 14 24146197 missense probably damaging 1.00
IGL01328:Dlg5 APN 14 24202351 missense probably damaging 0.98
IGL01532:Dlg5 APN 14 24158592 missense probably benign
IGL01621:Dlg5 APN 14 24148221 missense probably damaging 1.00
IGL01649:Dlg5 APN 14 24138691 missense probably damaging 1.00
IGL01733:Dlg5 APN 14 24170449 missense probably damaging 1.00
IGL02048:Dlg5 APN 14 24172203 missense possibly damaging 0.87
IGL02103:Dlg5 APN 14 24144346 missense probably damaging 1.00
IGL02138:Dlg5 APN 14 24158351 missense probably benign
IGL02146:Dlg5 APN 14 24202361 missense probably damaging 0.99
IGL02392:Dlg5 APN 14 24150209 missense probably damaging 1.00
IGL02427:Dlg5 APN 14 24166207 missense probably damaging 1.00
IGL02643:Dlg5 APN 14 24191182 missense probably damaging 1.00
IGL02649:Dlg5 APN 14 24146251 missense probably damaging 0.96
IGL02933:Dlg5 APN 14 24158499 missense probably benign 0.06
IGL02965:Dlg5 APN 14 24172023 missense probably damaging 1.00
IGL02988:Dlg5 APN 14 24166255 missense probably damaging 1.00
IGL03351:Dlg5 APN 14 24170454 missense probably benign 0.03
legerdemain UTSW 14 24164547 missense probably damaging 1.00
R0123:Dlg5 UTSW 14 24147206 missense probably benign
R0131:Dlg5 UTSW 14 24138649 missense probably damaging 1.00
R0709:Dlg5 UTSW 14 24146255 missense probably damaging 1.00
R0920:Dlg5 UTSW 14 24176397 missense probably damaging 1.00
R0924:Dlg5 UTSW 14 24135577 missense probably damaging 1.00
R0930:Dlg5 UTSW 14 24135577 missense probably damaging 1.00
R0981:Dlg5 UTSW 14 24154631 missense probably damaging 1.00
R1402:Dlg5 UTSW 14 24176608 missense probably benign 0.06
R1402:Dlg5 UTSW 14 24176608 missense probably benign 0.06
R1438:Dlg5 UTSW 14 24154605 missense possibly damaging 0.94
R1449:Dlg5 UTSW 14 24135643 missense possibly damaging 0.82
R1465:Dlg5 UTSW 14 24154696 splice site probably null
R1465:Dlg5 UTSW 14 24154696 splice site probably null
R1543:Dlg5 UTSW 14 24144448 missense probably damaging 1.00
R1824:Dlg5 UTSW 14 24149444 missense probably benign 0.28
R1899:Dlg5 UTSW 14 24148300 missense probably damaging 1.00
R1920:Dlg5 UTSW 14 24176571 missense probably damaging 1.00
R1921:Dlg5 UTSW 14 24176571 missense probably damaging 1.00
R1951:Dlg5 UTSW 14 24156469 splice site probably benign
R1968:Dlg5 UTSW 14 24164119 nonsense probably null
R2049:Dlg5 UTSW 14 24154647 missense probably damaging 1.00
R2070:Dlg5 UTSW 14 24136635 missense probably damaging 1.00
R2117:Dlg5 UTSW 14 24177758 nonsense probably null
R2139:Dlg5 UTSW 14 24170544 missense probably damaging 1.00
R2153:Dlg5 UTSW 14 24137157 missense probably damaging 1.00
R2283:Dlg5 UTSW 14 24158663 missense probably benign 0.00
R2293:Dlg5 UTSW 14 24158112 missense probably benign
R2356:Dlg5 UTSW 14 24170428 critical splice donor site probably null
R2362:Dlg5 UTSW 14 24158687 missense probably benign 0.04
R2513:Dlg5 UTSW 14 24164525 missense probably damaging 1.00
R3084:Dlg5 UTSW 14 24166190 missense probably damaging 1.00
R3086:Dlg5 UTSW 14 24166190 missense probably damaging 1.00
R3750:Dlg5 UTSW 14 24165260 missense probably damaging 1.00
R3780:Dlg5 UTSW 14 24190310 unclassified probably benign
R3782:Dlg5 UTSW 14 24190310 unclassified probably benign
R3828:Dlg5 UTSW 14 24146158 missense probably damaging 0.99
R4079:Dlg5 UTSW 14 24148260 missense possibly damaging 0.94
R4393:Dlg5 UTSW 14 24177989 critical splice acceptor site probably null
R4615:Dlg5 UTSW 14 24158168 missense probably damaging 1.00
R4664:Dlg5 UTSW 14 24137181 missense possibly damaging 0.90
R4712:Dlg5 UTSW 14 24177983 missense possibly damaging 0.94
R4796:Dlg5 UTSW 14 24144383 missense probably damaging 1.00
R4801:Dlg5 UTSW 14 24154689 missense probably damaging 1.00
R4802:Dlg5 UTSW 14 24154689 missense probably damaging 1.00
R4946:Dlg5 UTSW 14 24154361 missense probably damaging 0.99
R5022:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5023:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5057:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5234:Dlg5 UTSW 14 24192862 missense probably damaging 0.98
R5561:Dlg5 UTSW 14 24177792 missense probably benign 0.03
R5567:Dlg5 UTSW 14 24192913 nonsense probably null
R5570:Dlg5 UTSW 14 24192913 nonsense probably null
R5640:Dlg5 UTSW 14 24170461 missense probably damaging 1.00
R5646:Dlg5 UTSW 14 24158699 missense probably damaging 1.00
R5711:Dlg5 UTSW 14 24150648 missense probably damaging 1.00
R5810:Dlg5 UTSW 14 24146254 missense probably damaging 0.99
R5900:Dlg5 UTSW 14 24149447 missense probably damaging 1.00
R5964:Dlg5 UTSW 14 24164089 missense probably benign
R6190:Dlg5 UTSW 14 24190438 missense probably damaging 0.99
R6240:Dlg5 UTSW 14 24149528 splice site probably null
R6276:Dlg5 UTSW 14 24164568 missense probably damaging 1.00
R6339:Dlg5 UTSW 14 24158060 missense probably damaging 1.00
R6508:Dlg5 UTSW 14 24138706 missense probably benign 0.45
R6527:Dlg5 UTSW 14 24190448 missense possibly damaging 0.73
R6593:Dlg5 UTSW 14 24150652 missense probably benign 0.01
R6687:Dlg5 UTSW 14 24190373 missense probably damaging 1.00
R6965:Dlg5 UTSW 14 24149430 missense probably damaging 1.00
R7051:Dlg5 UTSW 14 24146195 missense possibly damaging 0.93
R7075:Dlg5 UTSW 14 24177797 missense possibly damaging 0.49
R7149:Dlg5 UTSW 14 24190424 missense probably benign 0.00
R7182:Dlg5 UTSW 14 24244856 missense
R7203:Dlg5 UTSW 14 24138655 missense probably damaging 1.00
R7216:Dlg5 UTSW 14 24136638 nonsense probably null
R7359:Dlg5 UTSW 14 24164547 missense probably damaging 1.00
R7466:Dlg5 UTSW 14 24245212 missense probably damaging 1.00
R7485:Dlg5 UTSW 14 24148322 missense probably benign
R7485:Dlg5 UTSW 14 24177839 missense probably damaging 0.98
R7629:Dlg5 UTSW 14 24245212 missense probably damaging 1.00
R7666:Dlg5 UTSW 14 24157799 missense probably damaging 1.00
R7804:Dlg5 UTSW 14 24165320 missense possibly damaging 0.46
R7861:Dlg5 UTSW 14 24245212 missense probably damaging 1.00
R7862:Dlg5 UTSW 14 24245212 missense probably damaging 1.00
R7864:Dlg5 UTSW 14 24245212 missense probably damaging 1.00
R7874:Dlg5 UTSW 14 24135619 missense probably damaging 1.00
R7913:Dlg5 UTSW 14 24137124 splice site probably null
R7981:Dlg5 UTSW 14 24158145 missense probably benign
R8147:Dlg5 UTSW 14 24158327 missense probably benign 0.07
R8204:Dlg5 UTSW 14 24160252 missense probably damaging 1.00
R8206:Dlg5 UTSW 14 24160268 missense possibly damaging 0.62
R8287:Dlg5 UTSW 14 24164385 missense probably benign 0.40
R8296:Dlg5 UTSW 14 24148260 missense possibly damaging 0.94
R8317:Dlg5 UTSW 14 24191230 missense probably damaging 0.98
R8327:Dlg5 UTSW 14 24146320 missense probably damaging 0.99
R8352:Dlg5 UTSW 14 24191193 missense probably damaging 1.00
R8353:Dlg5 UTSW 14 24158145 missense probably benign
R8452:Dlg5 UTSW 14 24191193 missense probably damaging 1.00
R8453:Dlg5 UTSW 14 24158145 missense probably benign
R8540:Dlg5 UTSW 14 24158699 missense probably damaging 1.00
R8701:Dlg5 UTSW 14 24176700 missense probably benign 0.04
R8925:Dlg5 UTSW 14 24156479 missense
R8927:Dlg5 UTSW 14 24156479 missense
R9025:Dlg5 UTSW 14 24149478 missense probably benign 0.00
R9102:Dlg5 UTSW 14 24149499 missense probably damaging 1.00
R9138:Dlg5 UTSW 14 24245308 missense probably damaging 0.98
R9165:Dlg5 UTSW 14 24146241 missense probably damaging 1.00
R9250:Dlg5 UTSW 14 24190475 missense probably benign 0.07
R9267:Dlg5 UTSW 14 24154677 missense probably damaging 1.00
R9269:Dlg5 UTSW 14 24192813 missense probably damaging 0.99
R9291:Dlg5 UTSW 14 24191161 missense probably damaging 0.99
R9387:Dlg5 UTSW 14 24147100 missense probably damaging 0.99
R9729:Dlg5 UTSW 14 24154613 missense probably benign 0.00
RF005:Dlg5 UTSW 14 24158493 nonsense probably null
YA93:Dlg5 UTSW 14 24155133 unclassified probably benign
Z1088:Dlg5 UTSW 14 24158094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACCCCAGACTAATGTCAAATAC -3'
(R):5'- AGATGGAGCTGCTGCAATCC -3'

Sequencing Primer
(F):5'- ATGCTATCTCCCAGCCCAG -3'
(R):5'- TGCTGCAATCCGAGCTCAC -3'
Posted On 2020-10-20