Incidental Mutation 'R8409:Ercc4'
ID652601
Institutional Source Beutler Lab
Gene Symbol Ercc4
Ensembl Gene ENSMUSG00000022545
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 4
SynonymsXpf
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R8409 (G1)
Quality Score187.009
Status Not validated
Chromosome16
Chromosomal Location13109684-13150617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 13130137 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 406 (R406P)
Ref Sequence ENSEMBL: ENSMUSP00000023206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023206] [ENSMUST00000129049] [ENSMUST00000141024]
Predicted Effect probably benign
Transcript: ENSMUST00000023206
AA Change: R406P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000023206
Gene: ENSMUSG00000022545
AA Change: R406P

DomainStartEndE-ValueType
Blast:DEXDc 8 187 1e-5 BLAST
ERCC4 684 764 1.11e-26 SMART
low complexity region 789 802 N/A INTRINSIC
PDB:2AQ0|B 835 917 6e-37 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000129049
AA Change: R316P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000141024
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with ERCC1 and is involved in the 5' incision made during nucleotide excision repair. This complex is a structure specific DNA repair endonuclease that interacts with EME1. Defects in this gene are a cause of xeroderma pigmentosum complementation group F (XP-F), or xeroderma pigmentosum VI (XP6).[provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice show impaired growth and do not survive longer than several weeks of age. Cultutred cells obtained from mutant mice were shown to be hypersensitive to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b T G 5: 121,501,477 N502H probably benign Het
Ahnak C T 19: 9,015,673 P4774S probably benign Het
Bptf A T 11: 107,062,669 S2082R probably damaging Het
Ccdc88a A G 11: 29,503,544 T1636A probably benign Het
Cep83 C T 10: 94,737,977 Q243* probably null Het
Dlg5 T G 14: 24,176,478 E452A probably damaging Het
Dsg1a T A 18: 20,340,151 D760E probably damaging Het
Elob G A 17: 23,824,959 R89C probably benign Het
En2 T C 5: 28,166,884 S120P probably benign Het
Extl2 G T 3: 116,027,262 V253F probably damaging Het
Fam217a T C 13: 34,916,898 E92G probably benign Het
Fbxo25 A T 8: 13,914,999 K17* probably null Het
Fig4 A T 10: 41,265,431 S277R probably benign Het
Gphn T C 12: 78,613,010 S429P probably damaging Het
Grm7 A G 6: 110,914,336 I177V probably benign Het
H13 C T 2: 152,689,893 P239L possibly damaging Het
Il12rb1 T A 8: 70,816,543 S456T possibly damaging Het
Irgq A G 7: 24,533,784 D350G probably benign Het
Isl2 T C 9: 55,542,500 S118P possibly damaging Het
Itpka C T 2: 119,749,860 R329C probably damaging Het
Itpripl1 G T 2: 127,140,766 Q479K probably benign Het
Kbtbd2 T C 6: 56,780,356 N132D probably damaging Het
Klb T C 5: 65,379,535 V736A probably damaging Het
Klhl3 T C 13: 58,019,428 D374G probably damaging Het
Mmp14 T A 14: 54,440,668 V582D probably damaging Het
Naalad2 A G 9: 18,330,838 V590A probably damaging Het
Olfr136 A G 17: 38,335,306 T50A probably benign Het
Olfr566 A T 7: 102,857,270 M4K probably benign Het
Olfr871 T G 9: 20,212,246 probably benign Het
Pianp T C 6: 124,999,251 S8P unknown Het
Ppbp T C 5: 90,768,627 S9P probably damaging Het
Ppp4r3a A G 12: 101,042,493 I696T probably benign Het
Psmd5 A G 2: 34,870,844 S27P probably damaging Het
Ralgapa2 T A 2: 146,244,977 R1561S Het
Rassf8 A G 6: 145,815,703 T252A probably benign Het
Rpe65 T A 3: 159,614,148 D218E probably benign Het
Sec23ip G A 7: 128,764,131 V575I probably damaging Het
Slc38a3 G A 9: 107,659,255 probably benign Het
Slco6c1 C T 1: 97,075,938 C495Y probably damaging Het
Speer4f2 C A 5: 17,377,421 T214K Het
Stox1 A G 10: 62,666,016 L255P probably benign Het
Sympk A G 7: 19,052,438 M989V probably benign Het
Tia1 T A 6: 86,425,470 Y202N possibly damaging Het
Tmem51 TCCCC TCCC 4: 142,037,685 probably null Het
Usp34 T C 11: 23,457,811 S2593P Het
Vmn2r85 A G 10: 130,425,388 V360A probably benign Het
Other mutations in Ercc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Ercc4 APN 16 13125369 missense possibly damaging 0.91
IGL00805:Ercc4 APN 16 13122004 missense possibly damaging 0.77
IGL01348:Ercc4 APN 16 13132934 missense probably damaging 1.00
IGL02406:Ercc4 APN 16 13123536 missense probably damaging 1.00
IGL03248:Ercc4 APN 16 13127593 missense probably damaging 1.00
Rapscallion UTSW 16 13126467 missense probably benign
Rascal UTSW 16 13132947 missense probably damaging 1.00
PIT4812001:Ercc4 UTSW 16 13144447 missense probably benign 0.29
R0212:Ercc4 UTSW 16 13123332 critical splice acceptor site probably null
R0505:Ercc4 UTSW 16 13126467 missense probably benign
R0962:Ercc4 UTSW 16 13130146 missense probably damaging 0.99
R1078:Ercc4 UTSW 16 13130197 missense probably benign 0.00
R1356:Ercc4 UTSW 16 13125282 missense probably damaging 0.99
R1420:Ercc4 UTSW 16 13130209 missense probably benign 0.01
R1554:Ercc4 UTSW 16 13147622 missense probably damaging 1.00
R1899:Ercc4 UTSW 16 13147787 missense probably damaging 1.00
R2128:Ercc4 UTSW 16 13147934 missense probably damaging 0.99
R2214:Ercc4 UTSW 16 13110024 missense probably damaging 1.00
R3757:Ercc4 UTSW 16 13144496 missense probably benign 0.28
R4072:Ercc4 UTSW 16 13130685 missense probably damaging 1.00
R4073:Ercc4 UTSW 16 13130685 missense probably damaging 1.00
R4075:Ercc4 UTSW 16 13130685 missense probably damaging 1.00
R4076:Ercc4 UTSW 16 13130685 missense probably damaging 1.00
R4646:Ercc4 UTSW 16 13147574 missense probably damaging 1.00
R4731:Ercc4 UTSW 16 13147607 missense probably damaging 1.00
R4756:Ercc4 UTSW 16 13123423 missense probably damaging 1.00
R4767:Ercc4 UTSW 16 13122095 missense probably damaging 1.00
R5011:Ercc4 UTSW 16 13123581 intron probably benign
R5013:Ercc4 UTSW 16 13123581 intron probably benign
R5301:Ercc4 UTSW 16 13130686 missense probably damaging 1.00
R5308:Ercc4 UTSW 16 13130164 missense probably damaging 1.00
R5684:Ercc4 UTSW 16 13130601 missense probably benign 0.35
R6083:Ercc4 UTSW 16 13110039 nonsense probably null
R6092:Ercc4 UTSW 16 13125261 missense probably benign 0.04
R6815:Ercc4 UTSW 16 13123435 missense probably damaging 0.99
R6953:Ercc4 UTSW 16 13130686 missense probably damaging 1.00
R7062:Ercc4 UTSW 16 13132947 missense probably damaging 1.00
R7199:Ercc4 UTSW 16 13147793 missense probably damaging 1.00
R7317:Ercc4 UTSW 16 13122113 missense probably benign 0.12
R7858:Ercc4 UTSW 16 13125305 missense probably damaging 0.98
R7948:Ercc4 UTSW 16 13130185 missense probably benign 0.00
R8245:Ercc4 UTSW 16 13130137 missense probably benign 0.00
R8408:Ercc4 UTSW 16 13130137 missense probably benign 0.00
RF007:Ercc4 UTSW 16 13123507 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TAAACAGTTCTGGCTTGGGC -3'
(R):5'- GAAGCACGCTCCTTGTTTGG -3'

Sequencing Primer
(F):5'- GGGCTTTGCTCCTTGGTCTATC -3'
(R):5'- CTCCTTGTTTGGAGCGGC -3'
Posted On2020-10-20