Incidental Mutation 'R8410:Syt2'
ID652609
Institutional Source Beutler Lab
Gene Symbol Syt2
Ensembl Gene ENSMUSG00000026452
Gene Namesynaptotagmin II
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R8410 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location134646677-134762593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 134746864 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 347 (E347K)
Ref Sequence ENSEMBL: ENSMUSP00000112438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121990] [ENSMUST00000188842]
Predicted Effect possibly damaging
Transcript: ENSMUST00000121990
AA Change: E347K

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112438
Gene: ENSMUSG00000026452
AA Change: E347K

DomainStartEndE-ValueType
PDB:4KBB|D 5 63 7e-16 PDB
transmembrane domain 65 87 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
C2 158 260 7.21e-22 SMART
C2 289 403 1.86e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000188842
AA Change: E347K

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140081
Gene: ENSMUSG00000026452
AA Change: E347K

DomainStartEndE-ValueType
PDB:4KBB|D 5 63 7e-16 PDB
transmembrane domain 65 87 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
C2 158 260 7.21e-22 SMART
C2 289 403 1.86e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a synaptic vesicle membrane protein. The encoded protein is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in this gene are associated with myasthenic syndrome, presynaptic, congenital, with or without motor neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele are viable but sterile, weigh less and show ataxia and altered spontaneous and Ca2+-evoked neurotransmitter release. Mice homozygous for a null allele die at weaning showing growth arrest, motor dysfunction and impaired Ca2+-evoked neurotransmitter release. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik A T 12: 110,668,711 M131K probably benign Het
Alox15 T C 11: 70,344,927 T569A probably benign Het
Arfgef1 A G 1: 10,159,642 V1278A possibly damaging Het
Armc5 C T 7: 128,240,151 R214C probably damaging Het
Asl A G 5: 130,013,510 F242L possibly damaging Het
Atoh1 G A 6: 64,729,650 G110S probably benign Het
Caskin1 T C 17: 24,502,149 F488L possibly damaging Het
Chsy1 T A 7: 66,125,463 L180Q probably damaging Het
D1Pas1 A T 1: 186,968,315 Q147L probably benign Het
Dnah7b T A 1: 46,356,659 probably null Het
Dsp A G 13: 38,196,815 E2512G possibly damaging Het
Eci2 T C 13: 34,978,035 K351R probably benign Het
Fam46b A G 4: 133,487,051 Q411R possibly damaging Het
Frem2 A G 3: 53,539,177 V2390A possibly damaging Het
Frmpd2 G A 14: 33,495,667 A40T probably damaging Het
Gapdhs G A 7: 30,737,910 P77S unknown Het
Heatr5a T A 12: 51,938,120 I637F probably benign Het
Jakmip1 G A 5: 37,117,484 V449M possibly damaging Het
Myh14 G T 7: 44,633,483 F737L probably damaging Het
Nbea A G 3: 56,037,263 V560A probably damaging Het
Olfr1291-ps1 T A 2: 111,499,702 M150K probably damaging Het
Olfr1396 A T 11: 49,113,684 I14N possibly damaging Het
Olfr702 T A 7: 106,824,538 probably benign Het
Olfr986 C T 9: 40,187,436 T107I possibly damaging Het
Prex2 G T 1: 11,153,657 R735L possibly damaging Het
Rrm2 T C 12: 24,708,623 S55P probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Ruvbl2 T C 7: 45,431,332 I19V probably benign Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Slc15a5 A T 6: 138,012,155 M147K Het
St3gal5 A G 6: 72,142,297 D158G probably benign Het
Stac3 G A 10: 127,503,330 D103N probably damaging Het
Ticrr A G 7: 79,667,675 E319G probably damaging Het
Ttn A G 2: 76,709,641 S34334P probably damaging Het
Uqcrb C A 13: 66,900,786 R100L unknown Het
Usp43 T G 11: 67,856,320 T854P probably damaging Het
Vmn2r102 T C 17: 19,677,934 Y404H possibly damaging Het
Wrn C T 8: 33,269,020 G970D probably damaging Het
Zfp456 A G 13: 67,372,796 Y27H probably damaging Het
Zfp516 G T 18: 82,956,333 G219C probably damaging Het
Zyx A T 6: 42,356,450 N437Y probably benign Het
Other mutations in Syt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02385:Syt2 APN 1 134745815 missense probably benign 0.07
IGL02476:Syt2 APN 1 134747631 missense probably benign 0.01
IGL02487:Syt2 APN 1 134740865 missense probably damaging 0.99
IGL02524:Syt2 APN 1 134741965 missense probably benign
IGL02611:Syt2 APN 1 134741882 missense possibly damaging 0.90
IGL03173:Syt2 APN 1 134743579 missense possibly damaging 0.81
IGL03303:Syt2 APN 1 134741911 missense probably benign 0.44
kringle UTSW 1 134747620 missense probably damaging 1.00
R1661:Syt2 UTSW 1 134747620 missense probably damaging 1.00
R1665:Syt2 UTSW 1 134747620 missense probably damaging 1.00
R2049:Syt2 UTSW 1 134746741 splice site probably benign
R2130:Syt2 UTSW 1 134746741 splice site probably benign
R2141:Syt2 UTSW 1 134746741 splice site probably benign
R3154:Syt2 UTSW 1 134741861 missense possibly damaging 0.95
R5392:Syt2 UTSW 1 134744021 missense probably damaging 1.00
R5431:Syt2 UTSW 1 134740957 missense probably benign 0.03
R6065:Syt2 UTSW 1 134747557 missense probably benign 0.00
R6381:Syt2 UTSW 1 134746850 missense probably damaging 1.00
R6816:Syt2 UTSW 1 134745800 missense probably damaging 1.00
R6923:Syt2 UTSW 1 134746763 missense possibly damaging 0.76
R7002:Syt2 UTSW 1 134744104 missense probably damaging 1.00
R7973:Syt2 UTSW 1 134740832 splice site probably null
R7994:Syt2 UTSW 1 134747592 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AGATGACCCCTCTGCTTCTG -3'
(R):5'- TTCAAAAGGGTCCTCTACAGGGTC -3'

Sequencing Primer
(F):5'- TCCTCTGGGCTTCCTAGGG -3'
(R):5'- GGTCCTCTACAGGGTCCCATC -3'
Posted On2020-10-20