Incidental Mutation 'R8410:D1Pas1'
ID652610
Institutional Source Beutler Lab
Gene Symbol D1Pas1
Ensembl Gene ENSMUSG00000039224
Gene NameDNA segment, Chr 1, Pasteur Institute 1
SynonymsPl10
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8410 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location186967416-186970627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 186968315 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 147 (Q147L)
Ref Sequence ENSEMBL: ENSMUSP00000035261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045108]
Predicted Effect probably benign
Transcript: ENSMUST00000045108
AA Change: Q147L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000035261
Gene: ENSMUSG00000039224
AA Change: Q147L

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 80 102 N/A INTRINSIC
low complexity region 104 122 N/A INTRINSIC
DEXDc 198 417 9.08e-66 SMART
HELICc 454 535 1.23e-35 SMART
low complexity region 580 596 N/A INTRINSIC
low complexity region 598 654 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik A T 12: 110,668,711 M131K probably benign Het
Alox15 T C 11: 70,344,927 T569A probably benign Het
Arfgef1 A G 1: 10,159,642 V1278A possibly damaging Het
Armc5 C T 7: 128,240,151 R214C probably damaging Het
Asl A G 5: 130,013,510 F242L possibly damaging Het
Atoh1 G A 6: 64,729,650 G110S probably benign Het
Caskin1 T C 17: 24,502,149 F488L possibly damaging Het
Chsy1 T A 7: 66,125,463 L180Q probably damaging Het
D930020B18Rik A G 10: 121,685,530 probably benign Het
Dnah7b T A 1: 46,356,659 probably null Het
Dsp A G 13: 38,196,815 E2512G possibly damaging Het
Eci2 T C 13: 34,978,035 K351R probably benign Het
Fam46b A G 4: 133,487,051 Q411R possibly damaging Het
Frem2 A G 3: 53,539,177 V2390A possibly damaging Het
Frmpd2 G A 14: 33,495,667 A40T probably damaging Het
Gapdhs G A 7: 30,737,910 P77S unknown Het
Heatr5a T A 12: 51,938,120 I637F probably benign Het
Jakmip1 G A 5: 37,117,484 V449M possibly damaging Het
Myh14 G T 7: 44,633,483 F737L probably damaging Het
Nbea A G 3: 56,037,263 V560A probably damaging Het
Olfr1291-ps1 T A 2: 111,499,702 M150K probably damaging Het
Olfr1396 A T 11: 49,113,684 I14N possibly damaging Het
Olfr702 T A 7: 106,824,538 probably benign Het
Olfr986 C T 9: 40,187,436 T107I possibly damaging Het
Prex2 G T 1: 11,153,657 R735L possibly damaging Het
Rrm2 T C 12: 24,708,623 S55P probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Ruvbl2 T C 7: 45,431,332 I19V probably benign Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Slc15a5 A T 6: 138,012,155 M147K Het
St3gal5 A G 6: 72,142,297 D158G probably benign Het
Stac3 G A 10: 127,503,330 D103N probably damaging Het
Syt2 G A 1: 134,746,864 E347K possibly damaging Het
Ticrr A G 7: 79,667,675 E319G probably damaging Het
Ttn A G 2: 76,709,641 S34334P probably damaging Het
Uqcrb C A 13: 66,900,786 R100L unknown Het
Usp43 T G 11: 67,856,320 T854P probably damaging Het
Vmn2r102 T C 17: 19,677,934 Y404H possibly damaging Het
Wrn C T 8: 33,269,020 G970D probably damaging Het
Zfp456 A G 13: 67,372,796 Y27H probably damaging Het
Zfp516 G T 18: 82,956,333 G219C probably damaging Het
Zyx A T 6: 42,356,450 N437Y probably benign Het
Other mutations in D1Pas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:D1Pas1 APN 1 186969412 missense possibly damaging 0.55
IGL00921:D1Pas1 APN 1 186968786 missense probably benign 0.44
R1693:D1Pas1 UTSW 1 186968029 missense probably benign
R2029:D1Pas1 UTSW 1 186968089 missense possibly damaging 0.53
R3732:D1Pas1 UTSW 1 186968097 missense probably benign 0.00
R3732:D1Pas1 UTSW 1 186968097 missense probably benign 0.00
R3733:D1Pas1 UTSW 1 186968097 missense probably benign 0.00
R3930:D1Pas1 UTSW 1 186968280 missense probably damaging 1.00
R5302:D1Pas1 UTSW 1 186969445 missense probably damaging 1.00
R5815:D1Pas1 UTSW 1 186968009 missense probably damaging 1.00
R6705:D1Pas1 UTSW 1 186968379 missense probably benign 0.00
R7023:D1Pas1 UTSW 1 186968008 missense probably damaging 0.96
R7747:D1Pas1 UTSW 1 186968677 missense probably benign 0.08
R7862:D1Pas1 UTSW 1 186968152 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTTTCTTCAGTGACCGC -3'
(R):5'- GCACAAGCCATCAAGTCTCTTTTC -3'

Sequencing Primer
(F):5'- GAGTGACTACGAGAGTGTT -3'
(R):5'- CTCCTTGATAATAGGAATAGCATGC -3'
Posted On2020-10-20