Incidental Mutation 'R8410:Slc15a5'
ID652621
Institutional Source Beutler Lab
Gene Symbol Slc15a5
Ensembl Gene ENSMUSG00000044378
Gene Namesolute carrier family 15, member 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R8410 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location137983586-138079916 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 138012155 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 147 (M147K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171804]
Predicted Effect
SMART Domains Protein: ENSMUSP00000107504
Gene: ENSMUSG00000044378
AA Change: M147K

DomainStartEndE-ValueType
transmembrane domain 7 28 N/A INTRINSIC
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
transmembrane domain 167 189 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171804
AA Change: M455K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129239
Gene: ENSMUSG00000044378
AA Change: M455K

DomainStartEndE-ValueType
Pfam:PTR2 101 485 4.3e-23 PFAM
low complexity region 536 543 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik A T 12: 110,668,711 M131K probably benign Het
Alox15 T C 11: 70,344,927 T569A probably benign Het
Arfgef1 A G 1: 10,159,642 V1278A possibly damaging Het
Armc5 C T 7: 128,240,151 R214C probably damaging Het
Asl A G 5: 130,013,510 F242L possibly damaging Het
Atoh1 G A 6: 64,729,650 G110S probably benign Het
Caskin1 T C 17: 24,502,149 F488L possibly damaging Het
Chsy1 T A 7: 66,125,463 L180Q probably damaging Het
D1Pas1 A T 1: 186,968,315 Q147L probably benign Het
D930020B18Rik A G 10: 121,685,530 probably benign Het
Dnah7b T A 1: 46,356,659 probably null Het
Dsp A G 13: 38,196,815 E2512G possibly damaging Het
Eci2 T C 13: 34,978,035 K351R probably benign Het
Fam46b A G 4: 133,487,051 Q411R possibly damaging Het
Frem2 A G 3: 53,539,177 V2390A possibly damaging Het
Frmpd2 G A 14: 33,495,667 A40T probably damaging Het
Gapdhs G A 7: 30,737,910 P77S unknown Het
Heatr5a T A 12: 51,938,120 I637F probably benign Het
Jakmip1 G A 5: 37,117,484 V449M possibly damaging Het
Myh14 G T 7: 44,633,483 F737L probably damaging Het
Nbea A G 3: 56,037,263 V560A probably damaging Het
Olfr1291-ps1 T A 2: 111,499,702 M150K probably damaging Het
Olfr1396 A T 11: 49,113,684 I14N possibly damaging Het
Olfr702 T A 7: 106,824,538 probably benign Het
Olfr986 C T 9: 40,187,436 T107I possibly damaging Het
Prex2 G T 1: 11,153,657 R735L possibly damaging Het
Rrm2 T C 12: 24,708,623 S55P probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Ruvbl2 T C 7: 45,431,332 I19V probably benign Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
St3gal5 A G 6: 72,142,297 D158G probably benign Het
Stac3 G A 10: 127,503,330 D103N probably damaging Het
Syt2 G A 1: 134,746,864 E347K possibly damaging Het
Ticrr A G 7: 79,667,675 E319G probably damaging Het
Ttn A G 2: 76,709,641 S34334P probably damaging Het
Uqcrb C A 13: 66,900,786 R100L unknown Het
Usp43 T G 11: 67,856,320 T854P probably damaging Het
Vmn2r102 T C 17: 19,677,934 Y404H possibly damaging Het
Wrn C T 8: 33,269,020 G970D probably damaging Het
Zfp456 A G 13: 67,372,796 Y27H probably damaging Het
Zfp516 G T 18: 82,956,333 G219C probably damaging Het
Zyx A T 6: 42,356,450 N437Y probably benign Het
Other mutations in Slc15a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Slc15a5 APN 6 138043538 missense probably damaging 1.00
IGL02090:Slc15a5 APN 6 138043600 missense probably benign 0.00
R0288:Slc15a5 UTSW 6 138017916 splice site probably benign
R0355:Slc15a5 UTSW 6 138018114 splice site probably benign
R0825:Slc15a5 UTSW 6 138018089 missense possibly damaging 0.84
R1470:Slc15a5 UTSW 6 138072994 missense probably benign 0.01
R1470:Slc15a5 UTSW 6 138072994 missense probably benign 0.01
R1721:Slc15a5 UTSW 6 138072847 splice site probably benign
R1897:Slc15a5 UTSW 6 138079764 missense possibly damaging 0.93
R4159:Slc15a5 UTSW 6 138072940 missense possibly damaging 0.84
R4415:Slc15a5 UTSW 6 138079756 missense probably benign 0.34
R4703:Slc15a5 UTSW 6 138055645 missense probably benign 0.08
R4951:Slc15a5 UTSW 6 138073066 missense probably damaging 1.00
R4996:Slc15a5 UTSW 6 138043585 missense probably damaging 1.00
R5268:Slc15a5 UTSW 6 138079753 missense probably damaging 1.00
R5310:Slc15a5 UTSW 6 138073036 missense probably benign 0.28
R5321:Slc15a5 UTSW 6 137987438 missense probably benign 0.08
R5963:Slc15a5 UTSW 6 138079693 missense probably damaging 1.00
R5988:Slc15a5 UTSW 6 138043531 missense probably benign 0.07
R7400:Slc15a5 UTSW 6 138073057 missense probably benign 0.01
R7515:Slc15a5 UTSW 6 138043498 missense possibly damaging 0.89
R7604:Slc15a5 UTSW 6 138079786 missense probably damaging 1.00
R7707:Slc15a5 UTSW 6 138079747 missense probably damaging 1.00
R8344:Slc15a5 UTSW 6 138079900 missense probably damaging 1.00
Z1188:Slc15a5 UTSW 6 138017958 missense
Predicted Primers PCR Primer
(F):5'- TGTCTCATGGGAAGTGACATTCTG -3'
(R):5'- AACCTGACTGTGCACTAACC -3'

Sequencing Primer
(F):5'- GGAAGTGACATTCTGTAATTACCTCC -3'
(R):5'- CTTAAAAATGTCCAACCCGGGG -3'
Posted On2020-10-20